ID: 1018855326

View in Genome Browser
Species Human (GRCh38)
Location 6:167670429-167670451
Sequence GAAACCCTGCTCCAGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 6, 3: 13, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855318_1018855326 3 Left 1018855318 6:167670403-167670425 CCTCCCTGGAGGGACCTCCCCCA 0: 1
1: 0
2: 0
3: 32
4: 383
Right 1018855326 6:167670429-167670451 GAAACCCTGCTCCAGAAGCATGG 0: 1
1: 0
2: 6
3: 13
4: 230
1018855319_1018855326 0 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855326 6:167670429-167670451 GAAACCCTGCTCCAGAAGCATGG 0: 1
1: 0
2: 6
3: 13
4: 230
1018855320_1018855326 -1 Left 1018855320 6:167670407-167670429 CCTGGAGGGACCTCCCCCACATG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1018855326 6:167670429-167670451 GAAACCCTGCTCCAGAAGCATGG 0: 1
1: 0
2: 6
3: 13
4: 230
1018855317_1018855326 4 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855326 6:167670429-167670451 GAAACCCTGCTCCAGAAGCATGG 0: 1
1: 0
2: 6
3: 13
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855326 Original CRISPR GAAACCCTGCTCCAGAAGCA TGG Intergenic