ID: 1018855327

View in Genome Browser
Species Human (GRCh38)
Location 6:167670430-167670452
Sequence AAACCCTGCTCCAGAAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855317_1018855327 5 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855319_1018855327 1 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855318_1018855327 4 Left 1018855318 6:167670403-167670425 CCTCCCTGGAGGGACCTCCCCCA 0: 1
1: 0
2: 0
3: 32
4: 383
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855321_1018855327 -10 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855320_1018855327 0 Left 1018855320 6:167670407-167670429 CCTGGAGGGACCTCCCCCACATG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855327 Original CRISPR AAACCCTGCTCCAGAAGCAT GGG Intergenic