ID: 1018855329

View in Genome Browser
Species Human (GRCh38)
Location 6:167670433-167670455
Sequence CCCTGCTCCAGAAGCATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855317_1018855329 8 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855322_1018855329 -10 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855320_1018855329 3 Left 1018855320 6:167670407-167670429 CCTGGAGGGACCTCCCCCACATG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855318_1018855329 7 Left 1018855318 6:167670403-167670425 CCTCCCTGGAGGGACCTCCCCCA 0: 1
1: 0
2: 0
3: 32
4: 383
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855321_1018855329 -7 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855319_1018855329 4 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855329 Original CRISPR CCCTGCTCCAGAAGCATGGG TGG Intergenic