ID: 1018855330

View in Genome Browser
Species Human (GRCh38)
Location 6:167670434-167670456
Sequence ACCACCCATGCTTCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855330_1018855333 -2 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855330_1018855340 28 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855340 6:167670485-167670507 GGTCTCTCCTTCTCCGTCCTGGG 0: 1
1: 0
2: 2
3: 22
4: 201
1018855330_1018855335 7 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855330_1018855339 27 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855339 6:167670484-167670506 AGGTCTCTCCTTCTCCGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 173
1018855330_1018855332 -3 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855330 Original CRISPR ACCACCCATGCTTCTGGAGC AGG (reversed) Intergenic