ID: 1018855331

View in Genome Browser
Species Human (GRCh38)
Location 6:167670440-167670462
Sequence GCTGAGACCACCCATGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855331_1018855333 -8 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855331_1018855332 -9 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855331_1018855335 1 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855331_1018855339 21 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855339 6:167670484-167670506 AGGTCTCTCCTTCTCCGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 173
1018855331_1018855340 22 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855340 6:167670485-167670507 GGTCTCTCCTTCTCCGTCCTGGG 0: 1
1: 0
2: 2
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855331 Original CRISPR GCTGAGACCACCCATGCTTC TGG (reversed) Intergenic