ID: 1018855332

View in Genome Browser
Species Human (GRCh38)
Location 6:167670454-167670476
Sequence GGTCTCAGCCTGCATTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855320_1018855332 24 Left 1018855320 6:167670407-167670429 CCTGGAGGGACCTCCCCCACATG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855323_1018855332 10 Left 1018855323 6:167670421-167670443 CCCCACATGAAACCCTGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 200
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855328_1018855332 -2 Left 1018855328 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855322_1018855332 11 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855325_1018855332 8 Left 1018855325 6:167670423-167670445 CCACATGAAACCCTGCTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855331_1018855332 -9 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855318_1018855332 28 Left 1018855318 6:167670403-167670425 CCTCCCTGGAGGGACCTCCCCCA 0: 1
1: 0
2: 0
3: 32
4: 383
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855319_1018855332 25 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855330_1018855332 -3 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855324_1018855332 9 Left 1018855324 6:167670422-167670444 CCCACATGAAACCCTGCTCCAGA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855321_1018855332 14 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855317_1018855332 29 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855332 Original CRISPR GGTCTCAGCCTGCATTCCCC AGG Intergenic