ID: 1018855335

View in Genome Browser
Species Human (GRCh38)
Location 6:167670464-167670486
Sequence TGCATTCCCCAGGGAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 252}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855321_1018855335 24 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855324_1018855335 19 Left 1018855324 6:167670422-167670444 CCCACATGAAACCCTGCTCCAGA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855325_1018855335 18 Left 1018855325 6:167670423-167670445 CCACATGAAACCCTGCTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855331_1018855335 1 Left 1018855331 6:167670440-167670462 CCAGAAGCATGGGTGGTCTCAGC 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855330_1018855335 7 Left 1018855330 6:167670434-167670456 CCTGCTCCAGAAGCATGGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855322_1018855335 21 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855328_1018855335 8 Left 1018855328 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855323_1018855335 20 Left 1018855323 6:167670421-167670443 CCCCACATGAAACCCTGCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 200
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855335 Original CRISPR TGCATTCCCCAGGGAGAATG AGG Intergenic