ID: 1018856291

View in Genome Browser
Species Human (GRCh38)
Location 6:167677671-167677693
Sequence CAGGTAGAAGAGAACGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018856291_1018856297 28 Left 1018856291 6:167677671-167677693 CCTACCACGTTCTCTTCTACCTG No data
Right 1018856297 6:167677722-167677744 ATGTCATTTGTCACATTGGTAGG No data
1018856291_1018856296 24 Left 1018856291 6:167677671-167677693 CCTACCACGTTCTCTTCTACCTG No data
Right 1018856296 6:167677718-167677740 TTAGATGTCATTTGTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018856291 Original CRISPR CAGGTAGAAGAGAACGTGGT AGG (reversed) Intergenic
No off target data available for this crispr