ID: 1018858876

View in Genome Browser
Species Human (GRCh38)
Location 6:167696345-167696367
Sequence GCCCTCCCCCATCAGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018858876_1018858883 -10 Left 1018858876 6:167696345-167696367 CCCATCCTCTGATGGGGGAGGGC No data
Right 1018858883 6:167696358-167696380 GGGGGAGGGCAGGGCAAGGTGGG No data
1018858876_1018858888 5 Left 1018858876 6:167696345-167696367 CCCATCCTCTGATGGGGGAGGGC No data
Right 1018858888 6:167696373-167696395 AAGGTGGGCGTGGAGCCTGGGGG No data
1018858876_1018858886 3 Left 1018858876 6:167696345-167696367 CCCATCCTCTGATGGGGGAGGGC No data
Right 1018858886 6:167696371-167696393 GCAAGGTGGGCGTGGAGCCTGGG No data
1018858876_1018858885 2 Left 1018858876 6:167696345-167696367 CCCATCCTCTGATGGGGGAGGGC No data
Right 1018858885 6:167696370-167696392 GGCAAGGTGGGCGTGGAGCCTGG No data
1018858876_1018858884 -5 Left 1018858876 6:167696345-167696367 CCCATCCTCTGATGGGGGAGGGC No data
Right 1018858884 6:167696363-167696385 AGGGCAGGGCAAGGTGGGCGTGG No data
1018858876_1018858887 4 Left 1018858876 6:167696345-167696367 CCCATCCTCTGATGGGGGAGGGC No data
Right 1018858887 6:167696372-167696394 CAAGGTGGGCGTGGAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018858876 Original CRISPR GCCCTCCCCCATCAGAGGAT GGG (reversed) Intergenic
No off target data available for this crispr