ID: 1018860425

View in Genome Browser
Species Human (GRCh38)
Location 6:167707171-167707193
Sequence AGCCCCGATGTGTCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018860423_1018860425 -3 Left 1018860423 6:167707151-167707173 CCTGAAGAAGCCAGGAGAACAGC No data
Right 1018860425 6:167707171-167707193 AGCCCCGATGTGTCTCCTCCAGG No data
1018860420_1018860425 21 Left 1018860420 6:167707127-167707149 CCCAGATGCAGGTGTGAACACAC No data
Right 1018860425 6:167707171-167707193 AGCCCCGATGTGTCTCCTCCAGG No data
1018860419_1018860425 29 Left 1018860419 6:167707119-167707141 CCATAAGGCCCAGATGCAGGTGT No data
Right 1018860425 6:167707171-167707193 AGCCCCGATGTGTCTCCTCCAGG No data
1018860421_1018860425 20 Left 1018860421 6:167707128-167707150 CCAGATGCAGGTGTGAACACACA No data
Right 1018860425 6:167707171-167707193 AGCCCCGATGTGTCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018860425 Original CRISPR AGCCCCGATGTGTCTCCTCC AGG Intergenic
No off target data available for this crispr