ID: 1018860732

View in Genome Browser
Species Human (GRCh38)
Location 6:167709094-167709116
Sequence CACAACAGACAGATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018860730_1018860732 3 Left 1018860730 6:167709068-167709090 CCTAGGTTCACGGCTGAAGCTTC No data
Right 1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG No data
1018860728_1018860732 8 Left 1018860728 6:167709063-167709085 CCCATCCTAGGTTCACGGCTGAA No data
Right 1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG No data
1018860729_1018860732 7 Left 1018860729 6:167709064-167709086 CCATCCTAGGTTCACGGCTGAAG No data
Right 1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG No data
1018860726_1018860732 13 Left 1018860726 6:167709058-167709080 CCTCACCCATCCTAGGTTCACGG No data
Right 1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018860732 Original CRISPR CACAACAGACAGATGGACAA AGG Intergenic
No off target data available for this crispr