ID: 1018861499

View in Genome Browser
Species Human (GRCh38)
Location 6:167713450-167713472
Sequence GAGGCTGGTGGAAGACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018861492_1018861499 15 Left 1018861492 6:167713412-167713434 CCATGCAGGCGTCTCCAGGGGCA No data
Right 1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG No data
1018861493_1018861499 1 Left 1018861493 6:167713426-167713448 CCAGGGGCAGAGACCTGTGTATC No data
Right 1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018861499 Original CRISPR GAGGCTGGTGGAAGACACCT GGG Intergenic
No off target data available for this crispr