ID: 1018862011

View in Genome Browser
Species Human (GRCh38)
Location 6:167717821-167717843
Sequence GAGACAAGGCAGATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018862005_1018862011 15 Left 1018862005 6:167717783-167717805 CCAGGGCTGTGGAAAGAGGGTGG No data
Right 1018862011 6:167717821-167717843 GAGACAAGGCAGATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018862011 Original CRISPR GAGACAAGGCAGATGGAACA AGG Intergenic
No off target data available for this crispr