ID: 1018863246

View in Genome Browser
Species Human (GRCh38)
Location 6:167727574-167727596
Sequence TAAGTGTGATGTTAGCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018863246_1018863250 22 Left 1018863246 6:167727574-167727596 CCCTACAGCTAACATCACACTTA No data
Right 1018863250 6:167727619-167727641 TCCCACTAAGACCAGGAACGAGG No data
1018863246_1018863253 27 Left 1018863246 6:167727574-167727596 CCCTACAGCTAACATCACACTTA No data
Right 1018863253 6:167727624-167727646 CTAAGACCAGGAACGAGGCACGG No data
1018863246_1018863249 15 Left 1018863246 6:167727574-167727596 CCCTACAGCTAACATCACACTTA No data
Right 1018863249 6:167727612-167727634 AAACTTTTCCCACTAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018863246 Original CRISPR TAAGTGTGATGTTAGCTGTA GGG (reversed) Intergenic
No off target data available for this crispr