ID: 1018863249

View in Genome Browser
Species Human (GRCh38)
Location 6:167727612-167727634
Sequence AAACTTTTCCCACTAAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018863247_1018863249 14 Left 1018863247 6:167727575-167727597 CCTACAGCTAACATCACACTTAC No data
Right 1018863249 6:167727612-167727634 AAACTTTTCCCACTAAGACCAGG No data
1018863246_1018863249 15 Left 1018863246 6:167727574-167727596 CCCTACAGCTAACATCACACTTA No data
Right 1018863249 6:167727612-167727634 AAACTTTTCCCACTAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018863249 Original CRISPR AAACTTTTCCCACTAAGACC AGG Intergenic
No off target data available for this crispr