ID: 1018867779

View in Genome Browser
Species Human (GRCh38)
Location 6:167759163-167759185
Sequence GAGCCAACCTAATTTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018867778_1018867779 -2 Left 1018867778 6:167759142-167759164 CCTGGATATATTTGGAAGTTAGA No data
Right 1018867779 6:167759163-167759185 GAGCCAACCTAATTTGCTGCTGG No data
1018867776_1018867779 15 Left 1018867776 6:167759125-167759147 CCTGCAAGTGATTCTGTCCTGGA No data
Right 1018867779 6:167759163-167759185 GAGCCAACCTAATTTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018867779 Original CRISPR GAGCCAACCTAATTTGCTGC TGG Intergenic
No off target data available for this crispr