ID: 1018869320

View in Genome Browser
Species Human (GRCh38)
Location 6:167769154-167769176
Sequence CTAAGCCACGCAGGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018869312_1018869320 4 Left 1018869312 6:167769127-167769149 CCATTTGAAAGGCCCCAGAAATA No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869315_1018869320 -10 Left 1018869315 6:167769141-167769163 CCAGAAATATTCACTAAGCCACG No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869307_1018869320 20 Left 1018869307 6:167769111-167769133 CCCTCCAAAGAGTGACCCATTTG No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869313_1018869320 -8 Left 1018869313 6:167769139-167769161 CCCCAGAAATATTCACTAAGCCA No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869305_1018869320 29 Left 1018869305 6:167769102-167769124 CCCAGACTTCCCTCCAAAGAGTG No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869306_1018869320 28 Left 1018869306 6:167769103-167769125 CCAGACTTCCCTCCAAAGAGTGA No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869309_1018869320 16 Left 1018869309 6:167769115-167769137 CCAAAGAGTGACCCATTTGAAAG No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869308_1018869320 19 Left 1018869308 6:167769112-167769134 CCTCCAAAGAGTGACCCATTTGA No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869314_1018869320 -9 Left 1018869314 6:167769140-167769162 CCCAGAAATATTCACTAAGCCAC No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data
1018869311_1018869320 5 Left 1018869311 6:167769126-167769148 CCCATTTGAAAGGCCCCAGAAAT No data
Right 1018869320 6:167769154-167769176 CTAAGCCACGCAGGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018869320 Original CRISPR CTAAGCCACGCAGGGCTGGG AGG Intergenic
No off target data available for this crispr