ID: 1018869618

View in Genome Browser
Species Human (GRCh38)
Location 6:167770869-167770891
Sequence CTGTCTGGATGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018869618_1018869630 21 Left 1018869618 6:167770869-167770891 CCCACTTCCCTCCATCCAGACAG No data
Right 1018869630 6:167770913-167770935 CCCAAGTCCTGAGACCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018869618 Original CRISPR CTGTCTGGATGGAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr