ID: 1018871490

View in Genome Browser
Species Human (GRCh38)
Location 6:167787065-167787087
Sequence TTAATTGAGCCTGAGATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018871489_1018871490 -10 Left 1018871489 6:167787052-167787074 CCTGTTTTGTCTCTTAATTGAGC 0: 1
1: 0
2: 1
3: 12
4: 191
Right 1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 148
1018871488_1018871490 13 Left 1018871488 6:167787029-167787051 CCATCTGCACTGATACTGCATTG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 148
1018871487_1018871490 14 Left 1018871487 6:167787028-167787050 CCCATCTGCACTGATACTGCATT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018871490 Original CRISPR TTAATTGAGCCTGAGATCTC AGG Intronic
900298823 1:1966402-1966424 TTAGCTGAGCCCGAGATCTCTGG - Exonic
903651056 1:24922347-24922369 TTGAATGAGCCTGAGAACTAGGG + Intronic
904726365 1:32551335-32551357 TCACTTGAGCCTGAGAGGTCAGG + Intronic
904792695 1:33035776-33035798 TTTCATGAGCCTGAGACCTCAGG - Intronic
905268348 1:36770444-36770466 TTAATTCAACCTGACATTTCAGG - Intergenic
908442325 1:64167723-64167745 TGAATTGAGCATGAGAGCCCTGG - Intronic
911502749 1:98708863-98708885 TCTGTTGAGCCTGAGATCTCTGG + Intronic
913295211 1:117312510-117312532 CTAAGTGTGCCTGAGATATCAGG - Intergenic
913576724 1:120182726-120182748 TAAAATGAGGCTGAGATCTATGG - Intergenic
914558632 1:148794161-148794183 TAAAATGAGGCTGAGATCTATGG - Intergenic
914614203 1:149336069-149336091 TAAAATGAGGCTGAGATCTATGG + Intergenic
915963339 1:160284973-160284995 TTAAGTGAACCTGAGATATTAGG - Intronic
922246197 1:223800216-223800238 TTAATTTAGCTGGAGAACTCAGG - Intronic
923533676 1:234831576-234831598 TCAATTGAGCCTGGGAAGTCAGG + Intergenic
1063157404 10:3392515-3392537 TTAATTTAGCCAAAAATCTCAGG - Intergenic
1063442523 10:6084443-6084465 TTGCTTGAGCCTGGGATTTCGGG + Intergenic
1064314904 10:14246182-14246204 TTAATTGGACCTGAGAAATCTGG - Intronic
1065606632 10:27424897-27424919 TTAATTGAGTTTGAGTTTTCTGG + Intergenic
1065643257 10:27806346-27806368 TTACTTGAGCCTGGGAGGTCAGG + Intergenic
1068873773 10:61974904-61974926 TTAAATTAGCCTGGGGTCTCGGG + Intronic
1069102786 10:64343917-64343939 TTAATTGAGGCTGGCATCACAGG - Intergenic
1071178481 10:82955390-82955412 TTAATTGAGCCTGTCAAGTCTGG + Intronic
1073400649 10:103254458-103254480 TTGATTGAGCCTGAGAGGCCAGG - Intergenic
1076124925 10:127966454-127966476 TTTATTGAGCCTGTGATATGTGG + Intronic
1076451523 10:130560133-130560155 CTAAATGTGCCTGAGATTTCAGG + Intergenic
1083848120 11:65348358-65348380 TTGCTTGAGCCTGGGATTTCAGG + Intronic
1083997384 11:66278998-66279020 TTAATGGACTCTGAGATCTGTGG - Intronic
1089306079 11:117527076-117527098 TCAATTGAGCCAGAGATGTGAGG + Intronic
1089910325 11:122092509-122092531 TTAAGTGAGCCTGCTTTCTCTGG - Intergenic
1090658164 11:128861494-128861516 ATAAATGAGCCTGTGATCACTGG - Intronic
1092950781 12:13500915-13500937 TTATTTGAGACTGATTTCTCTGG + Intergenic
1093015685 12:14152303-14152325 AGAATTGAACCTGAGTTCTCTGG + Intergenic
1093685677 12:22051099-22051121 TTAATTGAGGCAGATTTCTCTGG + Intronic
1096069948 12:48769330-48769352 TTGATTGAGCCTGGGATTTGAGG + Intronic
1102580144 12:113881254-113881276 GTAATTTAGCCTCAGAGCTCTGG + Intronic
1106294200 13:28395123-28395145 TAAATTGATCCTGACCTCTCAGG + Intronic
1108555346 13:51585312-51585334 TGAATTCAGCCTAAGATGTCTGG - Intronic
1109772827 13:66999229-66999251 TTAATACAGCCTGAAATGTCAGG + Intronic
1111112729 13:83735352-83735374 TTAATTAAGGCTCAGGTCTCTGG - Intergenic
1115176854 14:30572847-30572869 AAAATTGAGGCTGAGGTCTCAGG + Intronic
1116926810 14:50647469-50647491 TTACTTGAGCCCAAGATTTCAGG + Intronic
1117387823 14:55233724-55233746 TTAATTCAGCCAACGATCTCTGG + Intergenic
1118580093 14:67287132-67287154 TCACTTGAGCCTGGGAGCTCAGG + Intronic
1119743823 14:77030382-77030404 TTACTTGAGCCTGGGAGGTCAGG - Intergenic
1125061434 15:35430437-35430459 TTAATGGAGCCTGTGTGCTCTGG - Intronic
1125515928 15:40321131-40321153 ATAATTGAGCCTGATCTCCCCGG - Intergenic
1128955611 15:71940273-71940295 TTACTTGAGCCCGAGAGTTCAGG + Intronic
1134678608 16:16108135-16108157 TTAAATGGGCCTGGCATCTCTGG - Intronic
1137924618 16:52528496-52528518 TTTATTGGCCCTGTGATCTCTGG - Intronic
1147175195 17:38651485-38651507 TTGCTTGAGCCTGAGAGGTCAGG - Intergenic
1148163880 17:45468811-45468833 TTTGTGGAGCCTGGGATCTCAGG + Intronic
1149481180 17:57004307-57004329 TTGATTGAGCCTGAAAGCTTGGG + Intronic
1149614195 17:57984815-57984837 TAAATTGAAACTGAGAACTCTGG - Intronic
1159634283 18:70786430-70786452 TTCATTGAGAGTGACATCTCAGG - Intergenic
1160127283 18:76187837-76187859 AAAATTGTACCTGAGATCTCCGG + Intergenic
1160394123 18:78559435-78559457 TTCATTCAGCTTGAGATCTTGGG + Intergenic
1161470463 19:4454505-4454527 TTCCTTGAGCCTGGGAGCTCAGG - Intronic
1162571316 19:11475387-11475409 TCACTTGAGCCTGAGAGTTCAGG - Intronic
1166550201 19:43660708-43660730 TTTCTTGAGCCTGAGAGTTCTGG - Intronic
1167666279 19:50824131-50824153 TTAATTGAGACTGAGGTATATGG - Intergenic
925761534 2:7188988-7189010 TGAATTTCGCCTGAGATCTGGGG - Intergenic
926306054 2:11637895-11637917 TTACCTGAACCTGGGATCTCAGG + Exonic
928409102 2:31040559-31040581 TTAAGAGAGCTTGAGAACTCAGG - Intronic
928531074 2:32191806-32191828 TTACTTGAGCCTGGGAGTTCAGG + Intronic
930585280 2:53260417-53260439 CTGATTGAATCTGAGATCTCTGG - Intergenic
931061898 2:58539109-58539131 TTAATAGAGCCTGTAATCTTAGG + Intergenic
931300123 2:60971702-60971724 TTAAATGAGACTGAGGTCACTGG - Intronic
932341739 2:70966841-70966863 TTACTTGAGCCTGGGAGGTCAGG + Intronic
934081621 2:88473219-88473241 TTTATTCAGCCTTAAATCTCTGG - Intergenic
939596057 2:144124213-144124235 TTACATGAGACTGAGATCACTGG - Intronic
939691851 2:145273117-145273139 TCACTTGAGCCTGAGAGGTCAGG - Intergenic
940850146 2:158680164-158680186 TCAAGAAAGCCTGAGATCTCAGG - Intronic
942121644 2:172783565-172783587 TTGAAGGAGCCTGAGATCCCAGG - Intronic
942456029 2:176139047-176139069 TGAACTGGGCTTGAGATCTCTGG + Intergenic
943078372 2:183226491-183226513 GTAATTGTGCATGACATCTCTGG - Intergenic
943498471 2:188654664-188654686 TTAATTAAGCCTCAGTTGTCTGG - Intergenic
944589826 2:201206679-201206701 TTCCTTGAGCCTGAGAGTTCAGG - Intronic
947781289 2:232766341-232766363 TAAATGGAACCTTAGATCTCAGG + Intronic
947976994 2:234375431-234375453 TTACTTGTGCCTGTGAACTCAGG + Intergenic
948037652 2:234872334-234872356 AAAATTGAGGCTGATATCTCTGG + Intergenic
1169121153 20:3096603-3096625 TTTATTCAACCTGAGAGCTCCGG + Intergenic
1169872207 20:10259902-10259924 TTCATAGAGCCAGAGACCTCAGG + Intronic
1170642242 20:18164699-18164721 TTGCTTGAGCCTGAGAGTTCGGG - Intronic
1173527331 20:43743172-43743194 TTAATTGAGTCAGAGAGTTCAGG - Intergenic
1176093181 20:63327988-63328010 GTAAGTGAGGCTGAGATCTTTGG + Intronic
1176111857 20:63414500-63414522 TTCACTGAGCCTCAGATGTCAGG - Intronic
1182318165 22:29461582-29461604 TTACTTGAGCCTGGGAGGTCAGG - Intergenic
1183448156 22:37873707-37873729 TTTTTTGAGACTGAGATCTATGG - Intronic
950404874 3:12797954-12797976 TTAATAGAGCCTGGGATCCAAGG + Intronic
950939125 3:16875670-16875692 ATCATTGAGCCAAAGATCTCAGG - Intronic
952313271 3:32209659-32209681 TTTATTGAGGTTGTGATCTCAGG - Intergenic
955811594 3:62796337-62796359 TCACTTGAGCCCAAGATCTCTGG - Intronic
956173965 3:66456236-66456258 ATAATTAAACCTAAGATCTCAGG + Intronic
957771442 3:84697265-84697287 TTAATTGATCCTCATATCACTGG + Intergenic
958776897 3:98496375-98496397 TTCATTGAGCCTGAGAGATGGGG - Intergenic
960208196 3:114928523-114928545 TTCTTTGGGCCTGAGATCTGAGG - Intronic
960912007 3:122658626-122658648 TTAACTGAGTCTGAGAAGTCAGG + Intergenic
963807803 3:149743474-149743496 TAAATTAATCCTGAAATCTCAGG - Intronic
966012107 3:175091927-175091949 TTATTAAAGCCTGAGGTCTCAGG + Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967693683 3:192506589-192506611 TTACTTGAGGCTGAGAGTTCAGG - Intronic
968422214 4:495523-495545 TAAATTGAGTGTGAGATCTCAGG + Intronic
970949095 4:21731525-21731547 GTAAATGAGCATGAGATTTCTGG - Intronic
971434077 4:26600954-26600976 TTAATTGAGCCTCTCATCTGTGG + Intronic
973951654 4:56021593-56021615 CTAATTGAGAATGAAATCTCAGG - Intronic
974066115 4:57078956-57078978 TGAATTGAGCCAGAGAACTGGGG - Intronic
975043004 4:69768484-69768506 TAAAATAAGGCTGAGATCTCCGG + Intronic
975866396 4:78728050-78728072 TTGATTGAGCCTGGGAGGTCAGG - Intergenic
975980500 4:80153283-80153305 CAAATGGGGCCTGAGATCTCTGG - Intergenic
978240190 4:106505863-106505885 TTTGTTGACCCTGAGATGTCAGG - Intergenic
980379512 4:131993406-131993428 TTAATTGAGCATGAGATGGAAGG + Intergenic
987224790 5:15829094-15829116 TTAATATAGCTTGAGTTCTCAGG + Intronic
989322038 5:40146223-40146245 GCAATTAAGCCTGAGATTTCTGG - Intergenic
994150249 5:96439627-96439649 TTAACTGTGCCTGATGTCTCTGG - Intergenic
998044255 5:138973544-138973566 TCAGTTGAGCCTGGGAGCTCAGG - Intronic
999175854 5:149631253-149631275 TTAATTGAGCCTGGGAGGTAAGG - Intronic
1000899767 5:166898414-166898436 TTAGTCGAGCCTGAGATCATGGG - Intergenic
1002908081 6:1467187-1467209 TTAATTGAGTCTGAGCTTTAAGG - Intergenic
1003098556 6:3159906-3159928 TTAATTCAGCGTGAAATCTGAGG + Intergenic
1004085062 6:12439320-12439342 TGAATTGAGTCTTAGATATCTGG + Intergenic
1005192750 6:23244434-23244456 ATACATGAGCCTGAGAACTCAGG + Intergenic
1012736115 6:102946828-102946850 TTCACTGACCCTGACATCTCTGG + Intergenic
1014670353 6:124296751-124296773 TTAATTGCTCCTAATATCTCTGG - Intronic
1017475515 6:154787271-154787293 TCATTTGAGCCTGAGAGGTCGGG + Intronic
1017975055 6:159349762-159349784 CTATTAGAGCCTGAGCTCTCAGG - Intergenic
1018841623 6:167521594-167521616 TTTCCTGAGCCTGTGATCTCTGG - Intergenic
1018871490 6:167787065-167787087 TTAATTGAGCCTGAGATCTCAGG + Intronic
1019966442 7:4502791-4502813 TTACTTGAGCCTGGGAGGTCAGG + Intergenic
1020061724 7:5157526-5157548 TAAACTGAGCGTGAGGTCTCGGG - Intergenic
1021668254 7:23010026-23010048 TAAATGGAGCCTGAGATCCCTGG - Intronic
1021881721 7:25101443-25101465 TTGAGGGAGTCTGAGATCTCTGG + Intergenic
1022923062 7:35036088-35036110 TTATTTGTGGCTGTGATCTCAGG + Intronic
1024159515 7:46659929-46659951 TAAATTGAGGCTGAGATTTCTGG - Intergenic
1026263698 7:68777796-68777818 CAAATTGAGCCTGGGATCCCAGG + Intergenic
1026682576 7:72478619-72478641 TTACTAGGCCCTGAGATCTCAGG - Intergenic
1030497826 7:110321383-110321405 TTAATTCAGCCTGTAATTTCAGG + Intergenic
1030882201 7:114894310-114894332 TTAAATCAGCCTCAGATCCCAGG + Intergenic
1033727173 7:144131231-144131253 TAATTTGAGCCTGAGATCTTAGG + Intergenic
1034850350 7:154487558-154487580 TTAAAAGAGTCTGAGAGCTCAGG + Intronic
1039166401 8:34686056-34686078 TGAATTTAGTCTGAGACCTCAGG - Intergenic
1039756198 8:40525611-40525633 TTCATTGGCCTTGAGATCTCGGG - Intergenic
1045734567 8:105279955-105279977 TTCATTGGGCCTGAGTTCCCTGG + Intronic
1046260005 8:111755519-111755541 TCACTTGAGGCTGAGAGCTCAGG + Intergenic
1047330304 8:123880835-123880857 TTAATTGATCATCAGATATCAGG - Intronic
1049255984 8:141614165-141614187 TTTGTTGAGCCAGAAATCTCAGG + Intergenic
1056069455 9:82970836-82970858 TTCATTGAGTCTCAAATCTCAGG + Intergenic
1057552708 9:96063711-96063733 TTAATTGTGACTAAGTTCTCAGG - Intergenic
1059594016 9:115696444-115696466 TTATTTGATCCTGAGGTCACTGG + Intergenic
1060814714 9:126628598-126628620 TTAATTTCGCTTCAGATCTCTGG - Intronic
1060850207 9:126868808-126868830 TTACTTGAGCCCTAGATCTGTGG + Intronic
1185800400 X:3005458-3005480 TTGCTTGAGCCTGAGAGGTCAGG - Intergenic
1186770821 X:12816385-12816407 TTACTTGAGCCTGGGAGATCGGG - Intronic
1188442623 X:30228440-30228462 TTAATTGAGCATCAGCTCTTTGG + Intergenic
1188878857 X:35467441-35467463 ATAATTGAGCCTGTGACCTGGGG + Intergenic
1202035007 Y:20624048-20624070 TTTAATGACCCTGAGATTTCTGG + Intergenic