ID: 1018876070

View in Genome Browser
Species Human (GRCh38)
Location 6:167824311-167824333
Sequence GTCAATAAACTAATGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018876070 Original CRISPR GTCAATAAACTAATGTTGGT TGG Intergenic
905429265 1:37909745-37909767 GTCAATTAAGTACTGTTGGGGGG - Intronic
907180369 1:52564414-52564436 GTCAGTAAACTTATTTTGGCAGG + Intergenic
908198993 1:61774534-61774556 GTGAAGAATCTAATGGTGGTAGG - Intronic
909097543 1:71306963-71306985 GTCAATATGCTAAAGATGGTAGG - Intergenic
909266273 1:73561935-73561957 TTCAATAAATAAATGGTGGTTGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
911255315 1:95626503-95626525 TTCAATAAAGTTATTTTGGTGGG + Intergenic
911353647 1:96788543-96788565 TTCAGCAAACTAATATTGGTGGG + Intronic
913119443 1:115726274-115726296 GTCAAAAAACTACAGCTGGTGGG + Intronic
916220114 1:162434892-162434914 TTCAATAAATAAATGTTGGCTGG + Intergenic
920410474 1:205755931-205755953 GTCAGGAAAATAATGTGGGTGGG - Intergenic
920607872 1:207407673-207407695 GGCAATAAACAAATGTGGGCTGG + Intergenic
921492213 1:215791063-215791085 GTAATTAAACTAAATTTGGTGGG - Intronic
921593565 1:217030651-217030673 GTCAATAAACTAAAGGAGATGGG + Intronic
1063329818 10:5146370-5146392 TTCAATAAAATAATGTTGCTTGG + Intergenic
1067183734 10:44009607-44009629 CTCAAAATATTAATGTTGGTGGG + Intergenic
1068606798 10:59014462-59014484 CTCAATAGACTAATATTGCTTGG + Intergenic
1069101551 10:64328415-64328437 GTCAATAAACTAACTTTAATAGG + Intergenic
1072270800 10:93774406-93774428 TTCAAAAAACTTATCTTGGTGGG + Intronic
1072860264 10:98996331-98996353 GTAAAAAAATTAATGTTGGTGGG + Intronic
1080023477 11:27588951-27588973 GTCAAAAAACAAATGCTGGCAGG - Intergenic
1085912331 11:80842445-80842467 CTCAATAAACAAATGTTGAATGG + Intergenic
1090232944 11:125122491-125122513 ATCAATAAACATATATTGGTTGG + Intergenic
1093386431 12:18561306-18561328 GTCAATAAAAAAATGGAGGTGGG + Intronic
1099341034 12:81434677-81434699 GTCAGTACACTAATGCTGGAAGG - Intronic
1100344588 12:93715515-93715537 GTCAAAAAACTATTTTTGGGAGG + Intronic
1101525608 12:105526294-105526316 GTGAAGAAACTGATATTGGTAGG + Intergenic
1106625475 13:31416825-31416847 ATTAATAACCTAATGTTGCTTGG - Intergenic
1109073997 13:57809618-57809640 CTCCATAATTTAATGTTGGTAGG - Intergenic
1109593394 13:64516897-64516919 GTAAATAAACAAATGTTTCTGGG - Intergenic
1110896896 13:80764328-80764350 GTCATTAAACCAATATTGCTGGG - Intergenic
1111948439 13:94690157-94690179 TTAAATAAACAAATATTGGTTGG + Intergenic
1112268295 13:97946165-97946187 GTCATAATAATAATGTTGGTGGG - Intergenic
1112961187 13:105128682-105128704 GTCATTACACTAATGCTGTTTGG - Intergenic
1114158606 14:20136269-20136291 GAGAATAAACTAATTGTGGTAGG + Intergenic
1114608061 14:24014264-24014286 GTTCATAAACTACTGATGGTTGG + Intergenic
1115890381 14:38020151-38020173 GTCAATAAACTATGTTTTGTGGG + Intronic
1116233218 14:42245046-42245068 GTCATTAAACTAAGATTGGATGG - Intergenic
1117563904 14:56974110-56974132 TTCAATAATATAATGCTGGTAGG - Intergenic
1121859674 14:97305404-97305426 TTCAATAAACTATTATTGGATGG - Intergenic
1126543834 15:49851351-49851373 GTCAAAAAACAAATGCTGGCAGG + Intergenic
1130732151 15:86507573-86507595 GTGAATAAAATAATGTAGGTTGG + Intronic
1138545038 16:57713236-57713258 GTCAATAATCTCAAGTTGATTGG + Intronic
1138755461 16:59478940-59478962 GTCAGCAAAATAATGTGGGTTGG + Intergenic
1143989024 17:10940993-10941015 GTCAATACACTTCTGGTGGTTGG + Intergenic
1144020752 17:11239211-11239233 GGCACTAAACAAATGTTTGTTGG + Intergenic
1144213691 17:13036160-13036182 GTCAAAAGACTAAAGTGGGTTGG + Intergenic
1147510493 17:41065118-41065140 GTCAATAAACTAATTTTTCCTGG - Exonic
1149165993 17:53752734-53752756 GTCATTAAACTTATGTTCATGGG + Intergenic
1151122349 17:71807380-71807402 GCCAATAAGCTACTGATGGTGGG + Intergenic
1151242960 17:72772411-72772433 GTCACTAAACTACTGGGGGTTGG + Intronic
1152531217 17:80920345-80920367 GTCACTACACTAATGGGGGTGGG + Intronic
1153449722 18:5213616-5213638 GTCATTCAATTAATATTGGTTGG - Intergenic
1153757594 18:8299855-8299877 GTCAGAAAACTACTGTTTGTGGG - Intronic
1155480420 18:26280641-26280663 GTCAAAAAACAGATGCTGGTGGG + Intronic
1158464366 18:57676763-57676785 GTGATCAAACTAAGGTTGGTTGG - Intronic
1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG + Intronic
1167953032 19:53043138-53043160 GAGAATAAACTTATGTTGATTGG + Intergenic
928738157 2:34317107-34317129 CTCACTAAAATAATGTTGGATGG + Intergenic
930625057 2:53687659-53687681 TTCAATAAACTAAGTTTGGTGGG - Intronic
931727464 2:65125319-65125341 GTCAAGAAAATAATTTTGATTGG - Intronic
933340610 2:81021183-81021205 TTCAATAAACAAATGGTGCTTGG - Intergenic
938542383 2:132295063-132295085 GTCAATAAAGTTATGTTCATAGG + Intergenic
939495729 2:142925809-142925831 GTCAGTAAACTGGTGCTGGTGGG - Intronic
939608167 2:144277685-144277707 GTCAATCCAGTAATGTTGATAGG - Intronic
944534818 2:200698186-200698208 ATAAATAAATTAATGTTGATGGG + Intergenic
945604300 2:211909236-211909258 GGAAATAAAACAATGTTGGTTGG + Intronic
1169662654 20:7997607-7997629 GTGTATAAACTAATTTTAGTTGG - Intronic
1171871261 20:30527907-30527929 GTCAATAAAGTTATGTTCATAGG + Intergenic
1172585583 20:36081658-36081680 CTCAAAAACATAATGTTGGTAGG - Intergenic
1175018276 20:55815271-55815293 CTCAATAAACTAGTATTGATGGG + Intergenic
1178889738 21:36511006-36511028 CTCAATAAATTAATGTGAGTTGG + Intronic
949740143 3:7223001-7223023 GTTACTAAACTAATGTTGGAGGG + Intronic
953230594 3:41061741-41061763 GTCAATAAGCAAATAATGGTAGG + Intergenic
955588587 3:60509548-60509570 GGCAATAAACAAATGTTACTGGG - Intronic
956134090 3:66081953-66081975 GACGATAAATTAATGTTGGCTGG + Intergenic
959100331 3:102002507-102002529 GTCAATGAACCAATGTGGGGAGG + Intergenic
960433725 3:117600527-117600549 GTCAATAAACTAATCTTAAAAGG + Intergenic
970584291 4:17500395-17500417 TTCAATATACGAATGTTGGGGGG - Intronic
974521400 4:62985828-62985850 GTAAATATACTAATATTGGGGGG - Intergenic
975960315 4:79896120-79896142 GTCAATTAAATACTGTTGATTGG + Intergenic
976976933 4:91176991-91177013 CTCAATAAACTAGTATTGATGGG - Intronic
977643199 4:99380772-99380794 GTCAATTAGCTCAAGTTGGTTGG - Intergenic
978200926 4:106022851-106022873 ATGAATAAACAAATGTTGTTTGG - Intergenic
978245735 4:106570396-106570418 GTCATTAAACAACTGTTTGTTGG - Intergenic
978953271 4:114587605-114587627 ATCAATAAAATAATTTTTGTTGG + Intergenic
981033449 4:140149232-140149254 GTCAATAAAGTGGTGGTGGTTGG + Intronic
981653219 4:147082376-147082398 GTCAACAAACAAATGTAGTTGGG + Intergenic
984625770 4:182006237-182006259 GTCAATAAACAGTTATTGGTGGG - Intergenic
991531984 5:67625424-67625446 GTCAAGAAACAACTGTTGGTGGG - Intergenic
991633651 5:68681552-68681574 GTCAATAAACTGACATTAGTAGG + Intergenic
992484820 5:77184405-77184427 GTCTATAAACTATGGATGGTAGG + Intergenic
994312899 5:98296858-98296880 GTCAATAAACTAAATTAAGTGGG - Intergenic
995778176 5:115747678-115747700 TTCAATAAATTAATGCTGATGGG - Intergenic
997889959 5:137667113-137667135 GTAAATAAAATTATGTTGGAAGG + Intronic
998692882 5:144606624-144606646 AGCAATGAACTAATGTTGATTGG + Intergenic
1002817624 6:694397-694419 ATCACTAAACTAATGTTGCATGG + Intergenic
1003145760 6:3509159-3509181 TTCAATATACTAATTTTGGAGGG - Intergenic
1005600317 6:27420220-27420242 TTCATTAAACAAATGTTTGTTGG - Intergenic
1007131130 6:39475056-39475078 GTTAAGAAACAAATGTTGGAAGG + Intronic
1008617202 6:53237867-53237889 GTGAATAAGCTAATGTGGGCTGG - Intergenic
1010016692 6:71112694-71112716 GTTAATAAACTAATTTTCTTTGG - Intergenic
1011946376 6:92909196-92909218 GTGAAGAAACTCATGATGGTAGG + Intergenic
1013933271 6:115561869-115561891 GTAAGTAAACTAAAGTTGGCTGG + Intergenic
1015821923 6:137270575-137270597 GTAACTATATTAATGTTGGTAGG - Intergenic
1016533533 6:145085532-145085554 GTAAATAAAATGATGGTGGTCGG + Intergenic
1016580100 6:145619678-145619700 GGCAAAAAAGAAATGTTGGTGGG - Intronic
1017759040 6:157553788-157553810 ATCAATCAACTCATGTTTGTAGG - Intronic
1018876070 6:167824311-167824333 GTCAATAAACTAATGTTGGTTGG + Intergenic
1019895320 7:3977826-3977848 TTCAATAAATATATGTTGGTTGG + Intronic
1020639710 7:10740171-10740193 GTAAATAAACTAATCTTCTTTGG - Intergenic
1020697472 7:11431948-11431970 TTAAAGAAATTAATGTTGGTAGG - Intronic
1021949844 7:25764045-25764067 GGCAATAAACATTTGTTGGTTGG - Intergenic
1022199247 7:28100063-28100085 GTCTAAAATCTAATGTTGGAAGG + Intronic
1022354857 7:29604287-29604309 GACAACAAACTAATATTTGTTGG - Intergenic
1024885966 7:54142869-54142891 TTCAATAAAATATTGTGGGTGGG - Intergenic
1029893085 7:103952094-103952116 CTCAATAAAATAATTTAGGTTGG + Intronic
1030410392 7:109170722-109170744 GTCAACAAACTAATGTCTGTGGG + Intergenic
1031101978 7:117492200-117492222 GACAATTAAATAATGTTGGCTGG + Intronic
1032677874 7:134148298-134148320 CTCACTAAACTAATTTTGGATGG + Exonic
1033371012 7:140707727-140707749 GTTTCTAAACTAATGTCGGTTGG - Intronic
1033522731 7:142178018-142178040 GTCAAAAAATAGATGTTGGTGGG - Intronic
1037737637 8:21580183-21580205 TTCAACAAACAAATTTTGGTAGG - Intergenic
1038111868 8:24509102-24509124 GTCCTTAAAATAATGGTGGTGGG + Exonic
1040881443 8:52209470-52209492 GTCAATAAACTAATATTTATTGG - Intronic
1043142002 8:76602227-76602249 CTAAATCCACTAATGTTGGTGGG + Intergenic
1043749464 8:83917247-83917269 CTCAAGAAACAAAAGTTGGTGGG - Intergenic
1045951403 8:107855455-107855477 GGCAATCAACTAATGATTGTTGG + Intergenic
1046877089 8:119267254-119267276 GTCAATAAACTTTTGTTGAGTGG - Intergenic
1051072126 9:13183248-13183270 TTCATTTAGCTAATGTTGGTTGG - Intronic
1055115855 9:72604681-72604703 GTCATTAAAGAAATGCTGGTTGG + Intronic
1059849224 9:118318508-118318530 GTCAAAATACAAGTGTTGGTAGG - Intergenic
1059927541 9:119226250-119226272 GTCAATAAACTAATTATCATGGG + Intronic
1060120621 9:120986142-120986164 CTCAAGAGACTAAGGTTGGTGGG - Intronic
1060569228 9:124622919-124622941 GTCTATAAACCAATGGTTGTTGG + Intronic
1061890756 9:133617908-133617930 GGCAATAAATGAATGGTGGTTGG + Intergenic
1187432846 X:19240501-19240523 TTCAATAAATTTATGTTGGAAGG - Intergenic
1188168209 X:26888650-26888672 GTCAATAAACTATGGTTTGTGGG - Intergenic
1188406583 X:29818167-29818189 GTAAAGAAATGAATGTTGGTTGG + Intronic
1189628693 X:42927983-42928005 TACAATAAACTATTGTTGGCTGG - Intergenic
1193515895 X:82463045-82463067 ATCAATGAACTAATGTTGTTTGG - Intergenic
1194815318 X:98433660-98433682 GTGAATAAACAAATGATAGTTGG - Intergenic
1196373878 X:115009825-115009847 GTTAATAAACTCATCTTGGTTGG - Intronic
1196557719 X:117109788-117109810 GTCAATCAAATAATAGTGGTTGG + Intergenic
1197319790 X:125013770-125013792 GTCAATAAACTACAGTTAATTGG + Intergenic
1197563932 X:128057698-128057720 ATTAATAATCTAGTGTTGGTTGG - Intergenic