ID: 1018879323

View in Genome Browser
Species Human (GRCh38)
Location 6:167860966-167860988
Sequence CAGAGCATGGTGATGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018879318_1018879323 21 Left 1018879318 6:167860922-167860944 CCTGTTGTAAGATCAGAGAAAAA 0: 1
1: 0
2: 0
3: 23
4: 270
Right 1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018879323 Original CRISPR CAGAGCATGGTGATGTAGGC AGG Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901449148 1:9325528-9325550 CAGAGCATGGTGGTGTGAGCAGG + Intronic
903334320 1:22614691-22614713 AAGAGCATGGGGATGGGGGCTGG - Intergenic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
908168030 1:61477275-61477297 CTGAGCAGGGTGATGTAGGATGG + Intergenic
908755592 1:67466383-67466405 CAGATTATGATGATGAAGGCTGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918253548 1:182726349-182726371 CAGAGCATGGAGATTGAGACTGG - Intergenic
919912755 1:202122085-202122107 CAGAATATGGTGTTTTAGGCCGG + Intergenic
920194762 1:204219574-204219596 CAGAGCAGGATGTTCTAGGCTGG + Exonic
921698798 1:218244133-218244155 CAGTGCATGGTAATGCAGGTGGG + Intergenic
923097722 1:230788732-230788754 CAGAGCATGGTGAGGGGGGAAGG + Intronic
1063303208 10:4872592-4872614 CAGAGAGTGGAGATGCAGGCAGG - Intergenic
1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG + Intronic
1065952843 10:30667612-30667634 CTGAGCATGGTGGTGTGTGCAGG - Intergenic
1067734669 10:48840260-48840282 CAGAGTCTGGTGATGGAGGTGGG + Intronic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069728394 10:70595787-70595809 CGGAGCAGGGTGAAGTAGGTGGG + Intergenic
1070665638 10:78341307-78341329 AAGAGCATGGTGTTATATGCTGG - Intergenic
1071831721 10:89378697-89378719 CAGAGCATGGTGAAGAATGTAGG + Intronic
1072929867 10:99652737-99652759 GAGACCAGGGTGAGGTAGGCTGG - Intergenic
1073206486 10:101772115-101772137 CAGAGCCTGGTGATGTTGAGGGG - Intronic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075551310 10:123394870-123394892 CACAGCGTGGTGCTGCAGGCTGG + Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076521586 10:131084673-131084695 CAGCGCAGGATGATGTGGGCTGG + Intergenic
1076591579 10:131587248-131587270 CAGACCATGGGGATGTGGTCAGG + Intergenic
1083900456 11:65640916-65640938 CAGAGCATGCCCATGTGGGCCGG + Exonic
1085756610 11:79207045-79207067 CAGAGAATGGTGACATATGCTGG + Intronic
1089015450 11:115161636-115161658 CAGCACATGGTGATGGAGGTGGG + Intergenic
1089286908 11:117413159-117413181 CAGAGCCTGCTGATGGAAGCGGG - Exonic
1089465115 11:118679882-118679904 CAGAGCATGGTGGTGGGGGTGGG + Intergenic
1089750285 11:120646888-120646910 AACAGCCTGGTGAAGTAGGCAGG + Intronic
1090307121 11:125701058-125701080 TGGATCATGGTGATGAAGGCAGG + Intergenic
1090765975 11:129876726-129876748 GACAGAATGGTGACGTAGGCAGG + Exonic
1091366127 11:135022180-135022202 CAGAGCAGGGTGGTGGTGGCAGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1093284985 12:17247812-17247834 CTGAGCAAGGTGATGTGAGCTGG + Intergenic
1098234744 12:68407660-68407682 CCGAGCATGGTGGTGTGTGCCGG - Intergenic
1101589150 12:106111002-106111024 CAGAGCTTGGTGACCTAGGAAGG + Intronic
1102506126 12:113385488-113385510 CAGAGCAGGGTGGTGTGGGGTGG + Intronic
1103442742 12:120975642-120975664 CTGGGCATGGTGATGCACGCAGG - Intergenic
1103836375 12:123824330-123824352 CAGGGCAAGGTGATGTCTGCTGG + Intronic
1104647645 12:130508621-130508643 CAAAGCATGGTGGTGTGGGAGGG - Intronic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1105939425 13:25134060-25134082 AAGAGCATGGTGATAAAGGATGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106306617 13:28516850-28516872 CCGGGCATGGTGATGTGTGCCGG + Intergenic
1107159445 13:37209064-37209086 AAGAGCCTGGTGTTCTAGGCTGG - Intergenic
1110219140 13:73054351-73054373 CCAGGCATGGTGATGTATGCCGG - Intergenic
1112339223 13:98538701-98538723 CAAGGCATGGTTTTGTAGGCAGG - Intronic
1115571424 14:34670418-34670440 CAGAGCAAGGTGAGGAAGGGTGG - Intergenic
1121732173 14:96194484-96194506 CAGAGGGTGGTGATGGGGGCTGG + Intergenic
1122339419 14:101018669-101018691 CACAGCATGGTGAGGAAGGAAGG - Intergenic
1122459116 14:101880652-101880674 CAGAGCATGGTGGTGCGTGCTGG + Intronic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1126780117 15:52132610-52132632 CAGGGCATGGTGATGTGTGGAGG - Intronic
1126914029 15:53445220-53445242 CAGAGCATGGTTATGTCTTCAGG - Intergenic
1126945598 15:53815819-53815841 GAGAGCATGGTGATGGAGCAGGG + Intergenic
1127112378 15:55688465-55688487 CTGAGGATGGTGATCTAAGCTGG - Intronic
1128863383 15:71093356-71093378 CACAGCATGGCCATGCAGGCAGG - Intergenic
1129177180 15:73848426-73848448 CAGAGCATGGAGATCAAGGCAGG - Intergenic
1129509067 15:76106740-76106762 CAAAGCATCATGTTGTAGGCTGG - Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1136893393 16:33982991-33983013 CAGAGCCTGGAGAGGTGGGCAGG - Intergenic
1137980435 16:53064643-53064665 CAGAGCCTGGTGAGGAAGCCAGG + Intronic
1139531303 16:67543977-67543999 CAGGGCATGGGGCTGTAGCCTGG - Intronic
1203079644 16_KI270728v1_random:1140631-1140653 CAGAGCCTGGAGAGGTGGGCAGG + Intergenic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1143316125 17:6034800-6034822 GTGAGCATGGTGGTGTAGTCAGG + Intronic
1144314856 17:14050126-14050148 AAGAGGATGGTGATGAAGACAGG + Intergenic
1145978886 17:28999817-28999839 CAGAGCAGAGTGATGTGGGGTGG - Intronic
1146299640 17:31678109-31678131 CAGAGCATTGTTAAGGAGGCAGG + Intergenic
1146652726 17:34616479-34616501 CAGAGCAAGGACATGTAGCCGGG - Intronic
1147616802 17:41834251-41834273 CCGGGCATGGTGATGCATGCTGG + Intronic
1150804346 17:68307479-68307501 CAGCCCATGGTGGTGAAGGCAGG - Exonic
1151756784 17:76079808-76079830 CTCAGCATGTTGATGAAGGCTGG - Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153677541 18:7468860-7468882 CAGAGCAGGGGGATGTTTGCTGG - Intergenic
1156537258 18:37876160-37876182 CAGTGCATGGTGCTGGTGGCGGG - Intergenic
1157592847 18:48845988-48846010 CATAGCATGGAGATGTAGGTAGG - Intronic
1160522665 18:79517401-79517423 CAGAGGATGGTGGAGTAAGCTGG + Intronic
1160796622 19:948579-948601 CAGAGCCTGGGGCTGCAGGCGGG - Intronic
1164173984 19:22751582-22751604 CAGAGCATGGGCTTGCAGGCCGG - Intergenic
927173316 2:20388406-20388428 CAAAGCCTTGTGAGGTAGGCAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
928964365 2:36962649-36962671 CTGAGCATGGTGGTGTGTGCTGG - Intronic
929760749 2:44804342-44804364 CAGAGCGAGGAGATTTAGGCTGG - Intergenic
929807813 2:45162496-45162518 CAGAGGCTGGTGATGCAGGAAGG + Intergenic
929854113 2:45621407-45621429 AAGAGAATGCTGCTGTAGGCCGG + Intergenic
934054270 2:88238965-88238987 CACAGCTTGGTGAAGCAGGCAGG + Intergenic
934922833 2:98359733-98359755 CAGAGCCTGGAGATGTGGCCAGG - Intronic
935086253 2:99848105-99848127 CAGGGCATGGTGGTGTGTGCCGG + Intronic
935090719 2:99892606-99892628 GAGAGCAGGTTGATGCAGGCAGG - Intronic
937126997 2:119481365-119481387 CAGCTCATTCTGATGTAGGCTGG - Intronic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
943151160 2:184115390-184115412 CAGAGCAAGATGAAGCAGGCTGG + Intergenic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
944188125 2:196972036-196972058 CAGAGCTTGGTCATGCAGGCTGG + Intronic
946541298 2:220687491-220687513 CAGATCATGGTCATGAAGGGAGG + Intergenic
948048886 2:234964610-234964632 AAGTGCATGGTGATTTAGGGGGG + Intronic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948549701 2:238762162-238762184 CCGAGTAAGGTGATGTAAGCAGG - Intergenic
1172577725 20:36022155-36022177 CCGGGCATGGTGATGGTGGCCGG - Intronic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172962449 20:38808047-38808069 AAGAGGATACTGATGTAGGCAGG + Intronic
1173417887 20:42874114-42874136 CTGATCATGGTGATGCTGGCTGG - Intronic
1174650011 20:52116925-52116947 CTGGGCATGGTGGTGCAGGCTGG + Intronic
1174666676 20:52264664-52264686 AAAAACATGGTGATGTTGGCTGG + Intergenic
1174851199 20:53996861-53996883 GAGAGGATGGAGATTTAGGCAGG - Intronic
1175999409 20:62825276-62825298 CAGAGCTGGGTGATTTAGGCAGG + Intronic
1176925965 21:14749069-14749091 TAGAGCATGGGGATTAAGGCTGG + Intergenic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
949868874 3:8570185-8570207 CAGAGCATGGTGAGGAGGGTGGG + Intergenic
950191291 3:10978176-10978198 CAGAGCATGGTTCTGTAAACAGG + Intergenic
951985619 3:28617207-28617229 CAGATCAAGGTGATGTATGTGGG + Intergenic
954213649 3:49112158-49112180 CAGAGCCTGGTAAAGTAGGGTGG + Intronic
959958717 3:112271157-112271179 CAGAGGCTGGGGATGTAGGGAGG + Intronic
960119327 3:113931224-113931246 CAGAGGATGGTGATAGAGGCAGG + Intronic
967481538 3:189979067-189979089 CAAAGCATGATGGTGTAGGCAGG + Intronic
969554630 4:7898082-7898104 CAGAGCACTATGATGAAGGCTGG - Intronic
970468157 4:16348726-16348748 TAGAGCAGGGTAATGTAAGCTGG - Intergenic
979487005 4:121281519-121281541 CACAGCATGGTAATGTAACCAGG - Intergenic
981083840 4:140662353-140662375 CAGAGCATGGTTTTGTAGCTTGG - Intronic
983759339 4:171385647-171385669 CAGGGCATGGTGGTGAAGGGAGG - Intergenic
984471975 4:180187996-180188018 CACAGGAGGATGATGTAGGCTGG + Intergenic
987787210 5:22516650-22516672 CAGGGCATGGTGATGCATGCCGG + Intronic
991726480 5:69540760-69540782 CAGAGCATGGTAATGATGGAAGG + Intronic
991868477 5:71087114-71087136 CAGAGCATGGTAATGATGGAAGG - Intergenic
995478039 5:112567402-112567424 CAGAGCAGGATGATGTAAACAGG - Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996857441 5:128024835-128024857 CAGCGCTAGGTGATGAAGGCTGG + Intergenic
998133188 5:139661216-139661238 CAGAGCAGGGTGAGCTGGGCGGG + Intronic
1000450832 5:161384832-161384854 CTAAGAATGGGGATGTAGGCAGG - Intronic
1001420534 5:171583038-171583060 CAGACCATGTTGATTTAGGTGGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1008015260 6:46511436-46511458 CAGACCATTGGGATGTAGCCAGG + Intergenic
1008390717 6:50948262-50948284 CAGAGCATGGTGGGGTAAGAAGG - Intergenic
1012976359 6:105784769-105784791 CTGCCCATGGGGATGTAGGCCGG + Intergenic
1013634069 6:112011836-112011858 CAGACCATGGTGTTTTGGGCTGG - Intergenic
1018513422 6:164551689-164551711 CCAAGAATGGTGATGGAGGCCGG + Intergenic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1018978762 6:168585253-168585275 CAGACCAAAGTAATGTAGGCTGG - Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1030457144 7:109790415-109790437 AAGAGAAAGATGATGTAGGCTGG + Intergenic
1033774899 7:144598264-144598286 CAGAGCCTGGTGTTGTATGGGGG + Intronic
1033910766 7:146260519-146260541 CAGAGCATGCTGATGCAAGGAGG - Intronic
1035260054 7:157655364-157655386 CAGAGCTTGGAGATCAAGGCTGG - Intronic
1035343025 7:158176672-158176694 CAGAGCAGGTTGATGCATGCTGG - Intronic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1038621632 8:29149021-29149043 CAGAGCAAGGTGATAAAGGAAGG + Intronic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042251024 8:66756394-66756416 CAGAGGAGGGTTATGTGGGCTGG + Intronic
1042502775 8:69527505-69527527 CAGAGGATGGTGGTGTCAGCGGG + Intronic
1042642337 8:70950470-70950492 CAGAGCATGGTGAGTCTGGCTGG + Intergenic
1046590517 8:116200519-116200541 CCGGGCATGGTGATGCATGCCGG - Intergenic
1047761241 8:127956069-127956091 CAGAGCTTGGGGAGGTAGACAGG + Intergenic
1048667497 8:136679388-136679410 CAGGGCATGGTGGTGCATGCCGG + Intergenic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1050578059 9:7020002-7020024 GAGATCATAGTGATGTGGGCTGG + Intronic
1052722035 9:32183601-32183623 GAGAGAATGGTGATGTGGACAGG + Intergenic
1056731259 9:89168320-89168342 CTGAGCGTGGTGATGCATGCCGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058740938 9:107941406-107941428 CTGAGCCTGGTGAGGTTGGCAGG - Intergenic
1059324155 9:113493475-113493497 CAGAGCATGGGTTTGCAGGCAGG + Intronic
1060159825 9:121351470-121351492 CTCAGCATGGTGATGGAGCCTGG - Intronic
1061077799 9:128352456-128352478 AAGAGCCTGGTGATGGAAGCCGG + Intronic
1062436107 9:136547182-136547204 CAGAGCATGGTGGCAGAGGCAGG + Intergenic
1062681183 9:137782135-137782157 CAGAGGATGGTGCTGTGGGCGGG + Intronic
1203784032 EBV:117209-117231 CTGTCCATGGTGATGTAGGACGG - Intergenic
1186675101 X:11808252-11808274 CAGGGCATGGTGGTGTGCGCTGG + Intergenic
1187239013 X:17495853-17495875 CAGAGAATGGTGAGGTAACCTGG + Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1187551119 X:20306839-20306861 CAGAGCTTGGACACGTAGGCAGG - Intergenic
1188704831 X:33314748-33314770 CAGAGTAATGTGATGTAGACTGG - Intronic
1190466216 X:50727047-50727069 CAGGGCATAGTGATGCAGGAGGG - Intronic
1192346986 X:70318153-70318175 CCGGGCATGGTGGTGTATGCCGG - Intronic
1194381881 X:93202797-93202819 CCGGGCATGGTGGTGTACGCCGG - Intergenic
1200102630 X:153695526-153695548 CAGAGCCTGGAGAGGTGGGCAGG - Exonic
1201594338 Y:15651049-15651071 CAGAGAGTTGAGATGTAGGCAGG - Intergenic