ID: 1018883065 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:167904454-167904476 |
Sequence | GCATTTTGGGAAGCCGAGGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 602226 | |||
Summary | {0: 141, 1: 6338, 2: 107553, 3: 243972, 4: 244222} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018883065_1018883074 | 30 | Left | 1018883065 | 6:167904454-167904476 | CCTGCCTCGGCTTCCCAAAATGC | 0: 141 1: 6338 2: 107553 3: 243972 4: 244222 |
||
Right | 1018883074 | 6:167904507-167904529 | GCCCCGATTCATATCTCTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018883065 | Original CRISPR | GCATTTTGGGAAGCCGAGGC AGG (reversed) | Intronic | ||