ID: 1018883065

View in Genome Browser
Species Human (GRCh38)
Location 6:167904454-167904476
Sequence GCATTTTGGGAAGCCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602226
Summary {0: 141, 1: 6338, 2: 107553, 3: 243972, 4: 244222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018883065_1018883074 30 Left 1018883065 6:167904454-167904476 CCTGCCTCGGCTTCCCAAAATGC 0: 141
1: 6338
2: 107553
3: 243972
4: 244222
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018883065 Original CRISPR GCATTTTGGGAAGCCGAGGC AGG (reversed) Intronic