ID: 1018883066

View in Genome Browser
Species Human (GRCh38)
Location 6:167904458-167904480
Sequence CCTAGCATTTTGGGAAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481239
Summary {0: 15, 1: 944, 2: 19012, 3: 167698, 4: 293570}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018883066_1018883074 26 Left 1018883066 6:167904458-167904480 CCTCGGCTTCCCAAAATGCTAGG 0: 15
1: 944
2: 19012
3: 167698
4: 293570
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018883066 Original CRISPR CCTAGCATTTTGGGAAGCCG AGG (reversed) Intronic