ID: 1018883070

View in Genome Browser
Species Human (GRCh38)
Location 6:167904468-167904490
Sequence CACCTGTAATCCTAGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632768
Summary {0: 385, 1: 11009, 2: 97325, 3: 234439, 4: 289610}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018883070_1018883074 16 Left 1018883070 6:167904468-167904490 CCAAAATGCTAGGATTACAGGTG 0: 385
1: 11009
2: 97325
3: 234439
4: 289610
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018883070 Original CRISPR CACCTGTAATCCTAGCATTT TGG (reversed) Intronic