ID: 1018883070 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:167904468-167904490 |
| Sequence | CACCTGTAATCCTAGCATTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 632768 | |||
| Summary | {0: 385, 1: 11009, 2: 97325, 3: 234439, 4: 289610} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018883070_1018883074 | 16 | Left | 1018883070 | 6:167904468-167904490 | CCAAAATGCTAGGATTACAGGTG | 0: 385 1: 11009 2: 97325 3: 234439 4: 289610 |
||
| Right | 1018883074 | 6:167904507-167904529 | GCCCCGATTCATATCTCTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018883070 | Original CRISPR | CACCTGTAATCCTAGCATTT TGG (reversed) | Intronic | ||