ID: 1018883074

View in Genome Browser
Species Human (GRCh38)
Location 6:167904507-167904529
Sequence GCCCCGATTCATATCTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018883070_1018883074 16 Left 1018883070 6:167904468-167904490 CCAAAATGCTAGGATTACAGGTG 0: 385
1: 11009
2: 97325
3: 234439
4: 289610
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data
1018883066_1018883074 26 Left 1018883066 6:167904458-167904480 CCTCGGCTTCCCAAAATGCTAGG 0: 15
1: 944
2: 19012
3: 167698
4: 293570
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data
1018883065_1018883074 30 Left 1018883065 6:167904454-167904476 CCTGCCTCGGCTTCCCAAAATGC 0: 141
1: 6338
2: 107553
3: 243972
4: 244222
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data
1018883069_1018883074 17 Left 1018883069 6:167904467-167904489 CCCAAAATGCTAGGATTACAGGT 0: 400
1: 11888
2: 114238
3: 332875
4: 254090
Right 1018883074 6:167904507-167904529 GCCCCGATTCATATCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018883074 Original CRISPR GCCCCGATTCATATCTCTAA AGG Intronic