ID: 1018883475

View in Genome Browser
Species Human (GRCh38)
Location 6:167909367-167909389
Sequence ATGGAGAAGGTGAGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 1, 1: 0, 2: 7, 3: 126, 4: 1041}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018883475 Original CRISPR ATGGAGAAGGTGAGGATGGA GGG Intronic
900154984 1:1200336-1200358 ATGGAGGCTGTGGGGATGGAGGG - Intergenic
900530802 1:3152174-3152196 ATGGTGAAGGTGGGGAAGGCAGG + Intronic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900932867 1:5747749-5747771 AGGGAGAAAGGGAGGAGGGAGGG + Intergenic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901189731 1:7402379-7402401 CAGAAGAAGGTGAGGAGGGAAGG - Intronic
901218477 1:7568177-7568199 ATGGTGATGTTGATGATGGATGG - Intronic
901218504 1:7568394-7568416 ATGGTGATGTTGATGATGGATGG - Intronic
901218552 1:7568792-7568814 ATGGTGATGTTGATGATGGATGG - Intronic
901218563 1:7568901-7568923 ATGGTGATGTTGATGATGGATGG - Intronic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
901419761 1:9143031-9143053 AGGGAGAAGGGAAGGAAGGATGG - Intergenic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
902089870 1:13894405-13894427 AAAAAAAAGGTGAGGATGGATGG + Intergenic
902213854 1:14922874-14922896 ATTGGGAAGGTGAGGATGCGGGG + Intronic
902268593 1:15287072-15287094 ATGGGGAAGGACATGATGGACGG + Intronic
902407367 1:16191985-16192007 AGGGAGCAGGTGAGGAATGAGGG + Intergenic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902652613 1:17846351-17846373 ATGCTGAAGGTGAGATTGGAAGG - Intergenic
902677156 1:18016699-18016721 ATGCAGCAGGTGATGATGAAAGG + Intergenic
902942183 1:19808460-19808482 TAGGGGAAGGTGAGGAAGGACGG + Intergenic
903134230 1:21298803-21298825 ATGGAGCAGGTGAGGCAGGGTGG - Intronic
903241647 1:21986675-21986697 ATTGAGGAGGTGAGGAGGGCAGG + Exonic
903245154 1:22009849-22009871 ATTGAGGAGGTGAGGAGGGCAGG + Exonic
903377414 1:22875619-22875641 AGGGAGAAAGTGAGGAAGGAAGG - Intronic
903552566 1:24168172-24168194 AAGAAGAAAGGGAGGATGGAGGG - Intronic
904451711 1:30617130-30617152 ATGGAGAGTGTGAGCAAGGAAGG + Intergenic
904498453 1:30900808-30900830 ATGGGGGAGGGCAGGATGGATGG + Intronic
904652015 1:32013267-32013289 AGGGAGAAATTGAGGAAGGACGG - Intergenic
904755455 1:32766258-32766280 ATGGAGAAGTTTTGGAGGGAGGG + Intronic
904806546 1:33136190-33136212 AGGGAGAAAGGGAGAATGGAGGG - Intergenic
905106061 1:35564331-35564353 AGGGAGAAGGTGTGCATAGAGGG - Intronic
905323643 1:37134782-37134804 ATTGAGAAGGTGTGGGAGGAGGG + Intergenic
905420918 1:37843364-37843386 AAGGAGAAGTTGAGGATTTAAGG + Intronic
905878603 1:41449142-41449164 AAGAAGAAGGGGTGGATGGAGGG + Intergenic
905898151 1:41562496-41562518 AAGGAGAAAGAGAGGAAGGAAGG - Intronic
906285693 1:44586410-44586432 AGGGACAAGGTAAGGATAGAGGG + Intronic
906661982 1:47589553-47589575 CTGGAGACGGTGAGGAAGGAGGG - Intergenic
906935751 1:50212760-50212782 TTGCAGAAGGTGAGGAGGAAAGG - Intergenic
907117176 1:51979138-51979160 AGGAAGAAAGTGAGGTTGGAAGG + Intronic
907170179 1:52455678-52455700 AAGGAGGAAGGGAGGATGGATGG + Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907230615 1:52995257-52995279 ATGGAGAGGGTGATGTTGTAGGG - Intronic
907456668 1:54580776-54580798 ATGGAGATGGTGAGGCTGCAGGG + Intronic
907904066 1:58768213-58768235 ATGGAGATGGAAAGGAGGGAAGG - Intergenic
907968658 1:59358905-59358927 ATGAAGAAATTGAGGATGGAGGG + Intronic
908503457 1:64769736-64769758 ATGCTGAAGGTAAGGAAGGAAGG - Intronic
908968173 1:69791892-69791914 ATTGAGAAGATGAGTATGGAGGG + Intronic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909296402 1:73954436-73954458 ATAGAGAAGGGAAGGAAGGAAGG - Intergenic
909692061 1:78420714-78420736 AGGGAGGAGGGGAGGAAGGAGGG - Intronic
910517254 1:88075673-88075695 ATGAGGAAGCTCAGGATGGATGG - Intergenic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911054162 1:93696563-93696585 ATGGAGAAGGGCAGGATGGGAGG - Intronic
911138441 1:94469294-94469316 ATTGAGAAGATGAGCACGGAGGG - Intronic
911293850 1:96089302-96089324 AGGGAGGTGGGGAGGATGGAAGG - Intergenic
911534393 1:99082762-99082784 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
911627335 1:100139529-100139551 ATGGAGGAAGGGAGGATGGCAGG + Intronic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912305675 1:108563967-108563989 ATTGACAAAGTGAGGATGGGAGG + Intronic
912320707 1:108710133-108710155 ATGGAGAATGGCAGGAAGGAGGG - Intergenic
912462914 1:109848755-109848777 ATGGAGAAAGTATGAATGGATGG + Intergenic
913169835 1:116222012-116222034 AGGGAGGAAGTGAGGAGGGAAGG + Intergenic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
914430228 1:147613937-147613959 AGGGAGGAGGGGAGGAAGGAGGG - Intronic
914879075 1:151533918-151533940 AGTGAGAAGGTGAGGGTTGAGGG - Intronic
915065777 1:153222861-153222883 ATGGAGAATGTGGCTATGGAGGG - Intergenic
915107858 1:153545675-153545697 AAGGAGAAGGGGAGGCTGGTGGG - Intronic
915353222 1:155239602-155239624 CTGAAGAAGGTGAGGAGGAAGGG - Exonic
915860755 1:159441807-159441829 ATGGAAGAGGTGGGGATTGAAGG + Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916521483 1:165567341-165567363 AGGGATATGGGGAGGATGGAGGG + Intergenic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
916634040 1:166648940-166648962 ATGGAGACAGTGAGCATAGAAGG - Intergenic
916881604 1:169024426-169024448 AAGGAGAAGAGGAGGAAGGAAGG + Intergenic
916892730 1:169128475-169128497 AATGAGTAGGTGGGGATGGATGG + Intronic
917677481 1:177333537-177333559 ATACAGGAGGTGAGGATGGCAGG + Intergenic
918223224 1:182455256-182455278 AAGCAGAAGGTGAGGAGGAAAGG + Intronic
918420204 1:184356608-184356630 AGTGAGAAAGGGAGGATGGAAGG + Intergenic
918442586 1:184582795-184582817 ATTAAGAAGGTGAGGTTTGAGGG + Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
919166847 1:193906172-193906194 AGGGAAAAGGAGATGATGGAAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919798167 1:201333799-201333821 ATGGGGAAGGTCAGGATGCTTGG + Intergenic
919807230 1:201387270-201387292 AAGGAGGAGGTGAGGATGTCAGG + Intronic
919939965 1:202279302-202279324 ATGGAGCAGGTGGGTAAGGATGG + Intronic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920219203 1:204383941-204383963 CAGGAGGAGATGAGGATGGAGGG + Intergenic
920441798 1:205985756-205985778 ATGGGGATGGTGGGGATGGTGGG - Intronic
920634486 1:207686191-207686213 AAGGAGAAGGAAAGGAGGGAAGG - Intronic
921290184 1:213649850-213649872 ATGGTGGCGGTGAGGATGGGAGG + Intergenic
921342165 1:214145026-214145048 ATGGAGATGATGGAGATGGATGG + Intergenic
921479162 1:215644215-215644237 ATGGAGAAAGTGAGGACTAAAGG + Intronic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
921670767 1:217921515-217921537 ATGAATAAACTGAGGATGGAAGG + Intergenic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922198190 1:223377874-223377896 ATGGGGAAGTTGAGGATGAGTGG + Intergenic
922464036 1:225834412-225834434 AGGGAGAAAGGAAGGATGGACGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922723204 1:227909586-227909608 AGGGAGGAGGGGAGGAAGGAGGG + Intergenic
922723323 1:227909896-227909918 AGGAAGAAGGGGAGGAAGGAGGG + Intergenic
922745733 1:228042540-228042562 ATGATGAAGGGGATGATGGATGG + Intronic
922790593 1:228308859-228308881 ATGGATAATGGGTGGATGGATGG - Intronic
923334431 1:232954941-232954963 CTGGAGAAGATGATGTTGGAAGG + Intronic
923524085 1:234759075-234759097 ATGAAGGATGTGAAGATGGAGGG - Intergenic
923608178 1:235464436-235464458 AGGGAGAAGGTGGTGAGGGAGGG - Intronic
923707482 1:236356255-236356277 ATGGAGCAGGGGAGGAAGGGAGG + Intronic
923761502 1:236849404-236849426 ATGGAGGAGGTGGGGAAGGGTGG + Intronic
923827393 1:237515691-237515713 AAGGAGAAGGAGGGGAGGGAAGG - Intronic
924066572 1:240229335-240229357 ATGGATAAGGTGAGGAAGAGGGG - Intronic
924652232 1:245940062-245940084 GAGGGGAAGGTGAGGAGGGATGG - Intronic
1063016904 10:2087502-2087524 ATGGAGAAGGAGAGAAGGAAGGG + Intergenic
1063044066 10:2373715-2373737 AAGGAGAGAGAGAGGATGGAAGG - Intergenic
1063082757 10:2783796-2783818 ATGGAAGAGGCAAGGATGGATGG + Intergenic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063534202 10:6866992-6867014 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
1063647496 10:7899509-7899531 ATGGAGAAGGGGTGAATGGCTGG - Intronic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1063979869 10:11444612-11444634 AGGGAGTAGGTGAGTTTGGAGGG - Intergenic
1064149990 10:12854697-12854719 ATTGAGAAGGTAGAGATGGAGGG + Intergenic
1064473202 10:15658452-15658474 ATGTAGGAGCTGAGGACGGAGGG - Intronic
1064493514 10:15884715-15884737 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1065260626 10:23919879-23919901 CTGGAGAAGGTCAGGAAGGAAGG - Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065618357 10:27551964-27551986 AGTGAGAAGTTGATGATGGAGGG + Intergenic
1065644011 10:27815645-27815667 ATTGAGAAGATGAGAATGAATGG - Intronic
1065694836 10:28370217-28370239 AGGGAGAAAGAGAGGATGGAAGG + Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067455830 10:46418717-46418739 AGGGAGACGGTGATCATGGAGGG - Intergenic
1067471376 10:46541140-46541162 ATGGAGAAGGTGGGAAGGGTGGG - Intergenic
1067631370 10:47965922-47965944 AGGGAGACGGTGATCATGGAGGG + Intergenic
1068232744 10:54191961-54191983 AAGGAGAAGGAGGGGAAGGAAGG + Intronic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1069974029 10:72198193-72198215 ATGGAAGGGGTGAGGAGGGAGGG + Intronic
1069974064 10:72198284-72198306 ATGGAAGGGGTGAGGAGGGAGGG + Intronic
1070339217 10:75481246-75481268 AGGGTGAATGTGAGGATTGAAGG + Intronic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1070440777 10:76441072-76441094 ATGAAGAAGGTGTTGATGGAAGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070743644 10:78919381-78919403 AGGGAGTAAGTGGGGATGGAAGG + Intergenic
1070826155 10:79391649-79391671 AGGGAGCAGGGGAGGAGGGAAGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071751532 10:88482941-88482963 AAGGAGAAAGGGAGGAAGGAAGG - Intronic
1072043238 10:91629606-91629628 AAGGAAAAGTTGAGGAAGGATGG - Exonic
1072095108 10:92170648-92170670 ATGGAGAATGAAAGGAAGGAAGG + Intronic
1072717084 10:97759427-97759449 CTGGAGAGAGTGAGGAAGGAAGG - Exonic
1072801050 10:98392710-98392732 ATGGAGAAGCTGAGGCTTCATGG - Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073398609 10:103238876-103238898 AAGGAGAGAGTGAGGATGGAGGG + Intergenic
1073568439 10:104555576-104555598 AGGGAGAAGGAGAGAAGGGATGG + Intergenic
1073583221 10:104686161-104686183 TGGGAGAAGGTCAGGTTGGAGGG + Intronic
1073596007 10:104800864-104800886 ATGGAGAAGGTGGGATGGGAAGG - Intronic
1074008489 10:109453195-109453217 ATGGTGAAATTGAGGAGGGAGGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074827975 10:117228417-117228439 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
1075065590 10:119287119-119287141 ATGGAGAAGGCAGGGAGGGAAGG + Intronic
1075065674 10:119287410-119287432 AGGGAGAAGGTAAGGAGGGAGGG + Intronic
1075073277 10:119333286-119333308 ATCCAGATGGTGAGGATGGTGGG - Intronic
1075132776 10:119754698-119754720 ATGGAGAGGGTTGGGAGGGAGGG - Intronic
1075558321 10:123449312-123449334 ATGGACCAGGTGAGGAGGGCAGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075688604 10:124380404-124380426 ATGGAGGAGATGAGGATTCAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076237829 10:128879536-128879558 AAGAGGAAGGTGAGGCTGGAAGG + Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076318912 10:129564294-129564316 AAGGAGAGGGGGAGGAAGGAGGG - Intronic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076668219 10:132104794-132104816 TTGGACATGGTGAGGCTGGATGG - Exonic
1076713240 10:132350584-132350606 ACGGGGAAGATGAGGGTGGAAGG + Intronic
1076800135 10:132817933-132817955 CTGCCGACGGTGAGGATGGAGGG - Intronic
1076867610 10:133175752-133175774 ATGGATTAGTAGAGGATGGACGG + Intronic
1077308912 11:1879927-1879949 ATGGACAAGGTGAGGCCTGAGGG + Intronic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1078479368 11:11662710-11662732 GTGGAGGTGGTGGGGATGGATGG - Intergenic
1078636978 11:13060739-13060761 ATGGAGAAGGGCGGGAAGGAGGG + Intergenic
1078639410 11:13081232-13081254 ATGGGGATGGTGATGATGGTAGG + Intergenic
1078731003 11:13974001-13974023 AGTGAGCAGGTGAGGATGGTGGG - Intronic
1078755607 11:14205951-14205973 ATCAAGCAGGTGAAGATGGATGG - Intronic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079252041 11:18793517-18793539 ATGGAGAAAATGAGGAGGGAGGG - Intergenic
1079340220 11:19605600-19605622 AGGGAGCATGTGAGGATGGAAGG + Intronic
1079452514 11:20609614-20609636 AGAGAGAAGGTGAGACTGGAAGG - Intronic
1080451703 11:32383436-32383458 ATGGAGTAGGGGAGGATTGAAGG - Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083215429 11:61215837-61215859 TTGGGACAGGTGAGGATGGATGG - Intergenic
1083218313 11:61234666-61234688 TTGGGACAGGTGAGGATGGATGG - Intergenic
1083371993 11:62189691-62189713 GTGAAGATGGTGGGGATGGAAGG + Intergenic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1084031773 11:66485279-66485301 TTGGGGAAGGTGGGGATGGGGGG + Intronic
1084427541 11:69093911-69093933 CTGAAGACAGTGAGGATGGACGG + Intergenic
1084515430 11:69635785-69635807 AGTGAGAAGATGAGGATGGGTGG + Intergenic
1084713121 11:70856490-70856512 ATGGATAATGAGTGGATGGATGG + Intronic
1084870903 11:72098002-72098024 ATGGAGAAGGAGGGAATGAAGGG + Intronic
1084938397 11:72599482-72599504 ATGGGGGAGGTGAGGAAAGAAGG - Intronic
1085660993 11:78366630-78366652 ATGCACAAAGTGAGGATGGGGGG + Intronic
1085988966 11:81816929-81816951 AGGAAGAAGGGGAGGAAGGAGGG - Intergenic
1086100448 11:83093912-83093934 ATGCAGAACGTGAGGCTAGATGG - Intergenic
1086105110 11:83139010-83139032 CTGGAGAAGGTGATGATTAAGGG - Intergenic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1086162273 11:83735131-83735153 TTAGAGAGGGTTAGGATGGAAGG + Intronic
1086959620 11:92969267-92969289 CTGGAGAAGGTGCTGATGGTAGG - Intergenic
1087838565 11:102898948-102898970 CTTGGGAAGGTGAGGAGGGAGGG + Intergenic
1088396276 11:109373477-109373499 AAGGATCAGGTGTGGATGGATGG + Intergenic
1088584944 11:111353920-111353942 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088584963 11:111353977-111353999 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088847660 11:113681682-113681704 AGGGCGAAGGTGAGGCTGGGAGG - Intergenic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1089170243 11:116506602-116506624 AGGGAGAGGGTGGGGGTGGATGG + Intergenic
1089196284 11:116695685-116695707 ATGGAAAAGACAAGGATGGAAGG - Intergenic
1089337348 11:117734323-117734345 ATGGAAAAGGTGGGGAGAGATGG + Intronic
1089459037 11:118642058-118642080 AGGAAGAAGGGGAGGAAGGAAGG - Intronic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089632974 11:119794822-119794844 ATGGAGATGCTGAGGAGGGCAGG + Intergenic
1089659776 11:119978311-119978333 ATGGAGAAGGTGGTGAAGGAGGG + Intergenic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1090145945 11:124322762-124322784 ATAGAGAATGGAAGGATGGATGG - Intergenic
1091114740 11:133002714-133002736 AGGGAGAAAGAGAGGAGGGAAGG + Intronic
1091155555 11:133368278-133368300 AGGGAGAGGGAGAGGAGGGAAGG + Intronic
1091227650 11:133967318-133967340 GTGGAGAAGGTGGGTATGGGGGG - Intergenic
1091450388 12:569110-569132 TTGGAGGAGGTAGGGATGGAGGG + Intronic
1091745848 12:2992443-2992465 AGGGAGGGGGTGAGGATCGAGGG - Intronic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1092132967 12:6125192-6125214 ATGGTGAAGGTGGGGAGTGATGG + Intergenic
1092256451 12:6928614-6928636 ATCGGGAAGGTGGGGAAGGAGGG + Intronic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1092778613 12:11965178-11965200 AGGGAGAAAGTGAGGAAGGAAGG - Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094117009 12:26927091-26927113 ATGAAGTGGGTGAGGTTGGAAGG - Intronic
1094155819 12:27335808-27335830 AAGGAGAAGGGGAGGAGGGGAGG + Intronic
1094415642 12:30212200-30212222 GGGGAGAGGGTGAGGAGGGAGGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095281537 12:40357066-40357088 TGGGAGAAGGGGAGGATGAAGGG - Intronic
1095321733 12:40837187-40837209 ATGGAGGAGGTGGGCATGAAAGG - Intronic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096109112 12:49018718-49018740 ATGGAGACGGTGAGGAGTGCAGG - Exonic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096750262 12:53754117-53754139 ATGGATAATGGGAAGATGGAAGG + Intergenic
1097179141 12:57160948-57160970 CTGGAGAGGGCGTGGATGGATGG + Exonic
1097206190 12:57323267-57323289 TTGGAGAAGGACAGGAAGGAAGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1098100861 12:67015587-67015609 ATGGAGAGAGTGAGGAGGGAGGG + Intergenic
1098576029 12:72043313-72043335 AGGGAGAAGGAAAGAATGGATGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099046487 12:77727108-77727130 ATAGAGATGGTCAGGATGGTAGG + Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100894041 12:99159372-99159394 CTGGAGTAGGGAAGGATGGAGGG - Intronic
1101600460 12:106205283-106205305 AGTGAGAAAGTGAGAATGGAAGG + Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1103366831 12:120389765-120389787 AGGGAGGAGGGGAGGAAGGAAGG + Intergenic
1103366999 12:120390709-120390731 AAGGAGAAGGAAAGGAAGGAAGG + Intergenic
1103403940 12:120661539-120661561 ATGGATAGGTAGAGGATGGATGG - Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1104213327 12:126711519-126711541 AGGGAGAAGGGAGGGATGGAGGG + Intergenic
1104222277 12:126796582-126796604 AAGGAGAAAGGGAGGTTGGAAGG - Intergenic
1104710853 12:130984840-130984862 AGGGAGCAAGGGAGGATGGAAGG - Intronic
1104743993 12:131199271-131199293 ATGATGATGGTGAGGATGGTGGG - Intergenic
1104954873 12:132459448-132459470 ATGTAGGAGGTGAGGAAGGCAGG + Intergenic
1105927702 13:25022033-25022055 ATGGGGAAGATGGGGCTGGATGG - Intergenic
1106020889 13:25914552-25914574 CTGGTGAAGGAGAGGAGGGATGG - Intronic
1106118662 13:26838864-26838886 ATGGAGAAGGTCATCATGAAGGG + Intergenic
1106186196 13:27412087-27412109 AGGGTGGGGGTGAGGATGGAGGG + Intergenic
1106329041 13:28721921-28721943 ATTGTGTGGGTGAGGATGGAAGG - Intergenic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1106567450 13:30898544-30898566 TAGGAGAAAGTAAGGATGGAGGG - Intergenic
1106569713 13:30915865-30915887 ACGGAGTGGGTGAGGATGGCAGG - Intronic
1106793182 13:33177702-33177724 ATGGAGGAAGGGAGGAAGGAGGG + Intronic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107479720 13:40776007-40776029 AAGGAGAAAATGAGGCTGGATGG + Intergenic
1107683997 13:42878624-42878646 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
1108357730 13:49642461-49642483 AAGGAGAGAGTGAGGAAGGAAGG + Intergenic
1108609672 13:52071737-52071759 ATGGAGCAGGAGAGGAGGGCTGG + Intronic
1109175581 13:59151346-59151368 ATGGAGAGTGTGAGGAGGGAGGG - Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109984760 13:69965465-69965487 ATGGAGAAGGGGAGAAATGAGGG - Intronic
1110254161 13:73413511-73413533 ATGGAGAAGGTGAGGACTAGGGG + Intergenic
1110558899 13:76888759-76888781 CTGAAGAAGGTGAGAAGGGAGGG - Intergenic
1111957054 13:94770825-94770847 GTGAAGAAGGTGGGGAGGGAGGG + Intergenic
1112765478 13:102737506-102737528 ACGGAGAAGGTGAGGAGCAAGGG - Exonic
1113759971 13:112840361-112840383 ATGGGGAGGCTGAGGCTGGAAGG - Intronic
1113759988 13:112840424-112840446 ATGGGGAGGCTGAGGCTGGAGGG - Intronic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114647347 14:24263134-24263156 ATGGAACAGGTCAGGATGGATGG + Exonic
1114854764 14:26424833-26424855 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
1115760963 14:36579561-36579583 AGGAAGAAGGGGAGGATGAAGGG - Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118073397 14:62271116-62271138 ATGGAGAGAGGGAGGATGGATGG - Intergenic
1118094018 14:62516299-62516321 ATGAAGGAGGAGAGGATGCATGG - Intergenic
1118513822 14:66505857-66505879 ATGGAGATGGGGAGGGTTGATGG - Intergenic
1118994351 14:70822740-70822762 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1119141260 14:72269380-72269402 AGGGAGAAAGTGAGAAAGGAAGG - Intronic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119657172 14:76425504-76425526 AGGAAGGAGGTGAGGAGGGAGGG - Intronic
1119696098 14:76714524-76714546 AGGGAGAAGGACAGGATGGGAGG - Intergenic
1119931456 14:78551663-78551685 GGGGAGGAGGTGAGGAGGGAGGG - Intronic
1120224637 14:81776855-81776877 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
1120583930 14:86287424-86287446 AAGGAGGAAGTGAGGAAGGAAGG + Intergenic
1120929236 14:89831660-89831682 ATGGTGAAGGGAAGAATGGAAGG + Intronic
1121281679 14:92703534-92703556 GGGGAGAAGGTGAGGAAGGCTGG + Intergenic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121427516 14:93863097-93863119 AGGGAGCAGGTGTGGATGGTAGG + Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1123022373 14:105406745-105406767 GTGGAGTTGGTGAGGATGTAAGG + Intronic
1123058818 14:105585295-105585317 ATGGAGGATGGGTGGATGGAGGG - Intergenic
1123061259 14:105595626-105595648 GGGGAGAAGGTGAGGAGCGACGG - Intergenic
1123085713 14:105716537-105716559 GGGGAGAAGGTGAGGAGCGACGG - Intergenic
1124121501 15:26892750-26892772 ATGGAGAAGAAGAGGATCGTGGG + Intronic
1124374902 15:29123800-29123822 GTTGAGAAGGGGAGGAGGGATGG - Intronic
1124850039 15:33327721-33327743 ATAGAGATGGGGAGGAAGGAAGG - Intronic
1124957053 15:34366739-34366761 ACTGAGTAGGTGGGGATGGAGGG - Intronic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125364939 15:38903570-38903592 ATAGAGCAGGGGAGGTTGGAAGG - Intergenic
1125423263 15:39525686-39525708 AGGAAGGAGGGGAGGATGGAGGG + Intergenic
1125530703 15:40411683-40411705 GTGGAGAAGGTGAGTATAGGTGG + Exonic
1126216886 15:46165710-46165732 ATGGACAAAGGGAAGATGGATGG + Intergenic
1126960956 15:53993532-53993554 TGAGAGAAGGTGAGGATGGGAGG + Intergenic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1127341391 15:58048524-58048546 ATTGAGAAGGGAAGTATGGATGG + Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127560581 15:60132515-60132537 AGGGAGAAGGAAAGGAGGGAGGG + Intergenic
1127560601 15:60132584-60132606 AGGGAGAAGGAAAGGAGGGAGGG + Intergenic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128858608 15:71044676-71044698 CTGGAGAAGGTAAGGTGGGAGGG + Intronic
1129119682 15:73388447-73388469 ATGGGGCAGGTGAAGAGGGAGGG + Intergenic
1129815597 15:78550502-78550524 ATAGAGACGGTGAGCAGGGAAGG + Exonic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1130042559 15:80417607-80417629 CAGGAGAGGGTGAGGAGGGAAGG - Intronic
1130175914 15:81570627-81570649 TTGGAGAAGGTGGGGAAAGAAGG - Intergenic
1130226096 15:82059155-82059177 AAGGAGAAGGAGAGGAGGGGAGG - Intergenic
1130856023 15:87840841-87840863 ATAGAGAAAGTGAGGGAGGAAGG + Intergenic
1131014138 15:89043466-89043488 AAGGAGAAGGAGAGGAAGAAGGG + Intergenic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131313086 15:91308276-91308298 AGGAAGGAGGTGAGGATGGAGGG + Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131856554 15:96603256-96603278 ATGGAGGTGGTGGTGATGGATGG + Intergenic
1132030854 15:98437706-98437728 ATGGAGGATGGGTGGATGGATGG + Exonic
1132091173 15:98949003-98949025 ATGGAGAGGATGAGTAAGGATGG - Intronic
1132346897 15:101114015-101114037 AGGGAGAAGGAGAGCATGGGAGG - Intergenic
1132374854 15:101322333-101322355 ATGGAAAGGGAGAGGATGGGCGG - Intronic
1132911949 16:2318307-2318329 GTGGGGCAGGTGAGGAAGGAAGG - Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133008156 16:2896142-2896164 ATGGGGAAAGTGGGGTTGGATGG + Intronic
1133013725 16:2929403-2929425 ATGGGGAAAGTGGGGTTGGATGG + Intronic
1133073428 16:3262045-3262067 ACGGAGGAGGAGTGGATGGAGGG + Intergenic
1133398112 16:5464540-5464562 AAGGAGAAGGAGATGATGCAAGG - Intergenic
1133415854 16:5606460-5606482 AGAGAGAAGGTGAGGAAGGAAGG - Intergenic
1133429365 16:5723296-5723318 TTGGAGAAGCTTGGGATGGATGG + Intergenic
1133437734 16:5794296-5794318 GAGGTGAAGGTGAAGATGGAAGG - Intergenic
1133725641 16:8534957-8534979 ATGGAGAAGGGGATGATGACAGG - Intergenic
1133732438 16:8589184-8589206 CCGGGGAGGGTGAGGATGGAGGG - Intronic
1133839458 16:9394616-9394638 AAGGAGGAAGTGAGGGTGGAAGG - Intergenic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1134476368 16:14577574-14577596 TTTGTGAAGGTGAGGAAGGAGGG - Intronic
1134849582 16:17469822-17469844 ACAGAGAAGGTGAAGACGGAAGG + Intronic
1135134007 16:19874463-19874485 ATGGAGGAAGTGAGGATGGGAGG - Intronic
1135548128 16:23379192-23379214 ATGGAGAGGTGGATGATGGAGGG - Intronic
1136093722 16:27938706-27938728 AGTAAGAAGGTGAGGATGGATGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136179225 16:28539338-28539360 ATGCAGGACGTGAGGAAGGAGGG + Intergenic
1136268018 16:29132148-29132170 AGGGAGAGAGGGAGGATGGAGGG + Intergenic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136604608 16:31325040-31325062 CTGGAGGAGGTGAGGAGGAAAGG - Intronic
1137386130 16:48044131-48044153 ATGGTGAATGGGTGGATGGATGG - Intergenic
1137463264 16:48685404-48685426 TAGGAGAATGAGAGGATGGATGG - Intergenic
1137554196 16:49460475-49460497 ATGGAGAAGGGGAGGTTTGAGGG + Intergenic
1137570906 16:49565847-49565869 ATGGAAAAGATAAGGATGGAAGG + Intronic
1137576407 16:49603034-49603056 AAGGAGAAAGGGAGGATGGGAGG + Intronic
1137757649 16:50915282-50915304 ATGGAGCAGAGGAGGAGGGAGGG + Intergenic
1137909968 16:52367618-52367640 ATGGTAAAGGTGAGGATTGAGGG + Intergenic
1137955413 16:52824492-52824514 GAGGGGAAGGTGAGGAAGGAAGG - Intergenic
1137973094 16:53005226-53005248 ATGGAAAAGTGGAGTATGGATGG + Intergenic
1138519296 16:57561909-57561931 ATGAGGAAGCTGAGGATGAAGGG - Intronic
1138543931 16:57705389-57705411 TTGGCGAATGGGAGGATGGATGG - Intronic
1138777744 16:59744591-59744613 ATAGAGAAGGAAAGGAAGGAAGG - Intronic
1139031581 16:62888658-62888680 ACTGAGAAGGTGAGGAGGAAGGG - Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139306442 16:65990268-65990290 ATAGAGAAAGAGAGGAAGGAAGG + Intergenic
1139310593 16:66024904-66024926 AGGGAGAAGGCACGGATGGATGG - Intergenic
1139530378 16:67539743-67539765 CTGGACAAGGTGAGTATGCATGG + Exonic
1139538965 16:67599489-67599511 ATGGTGAGTGTGAGGATGCAAGG - Intronic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140170414 16:72598736-72598758 CTGGAGAATGGGAGGAGGGAGGG + Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1140647025 16:77043175-77043197 ATGGAGAAGTTTATAATGGATGG + Intergenic
1140702462 16:77593889-77593911 TTGTAGAAGGTGAGGACAGAAGG + Intergenic
1140898425 16:79346588-79346610 ATTTTGAAGGTGATGATGGATGG + Intergenic
1141606495 16:85156929-85156951 ATGGAGAAAGGATGGATGGATGG - Intergenic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141873005 16:86802106-86802128 GTGGTGAAGGTGATGATTGATGG + Intergenic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1142145697 16:88492096-88492118 AGGGAGAAGGCGAGGAGGGATGG - Intronic
1142255614 16:89012383-89012405 ATGGAGAATGGGTGGACGGATGG - Intergenic
1142284111 16:89164774-89164796 ATGGAGGAGGTGGGGAGGGGCGG + Intergenic
1142387204 16:89773257-89773279 AGCGTGATGGTGAGGATGGATGG - Exonic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143022811 17:3925514-3925536 TGGGAGAAGTGGAGGATGGAAGG - Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143908948 17:10231720-10231742 AGAGAGAAGATGGGGATGGATGG - Intergenic
1144184628 17:12785481-12785503 GAGGAGGAGGTGAGGAAGGACGG - Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144781276 17:17809782-17809804 AAGGTGAAGGTGAAGCTGGACGG + Intronic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1145278989 17:21454965-21454987 AGGGAGAAGGAGAGGAGGGGAGG - Intergenic
1145398866 17:22515486-22515508 AGAGAGAAGGAGAGGAGGGAAGG + Intergenic
1145978734 17:28999092-28999114 ATGGAGAATGGAAGGATGGATGG + Intronic
1145981288 17:29013280-29013302 AAGGAGAAGTGGAGGATTGAGGG + Intronic
1146001141 17:29131224-29131246 ATGGAGTAGGTGGGGATTGCAGG - Intronic
1146057189 17:29587397-29587419 GGTGAGAAGGTGAGGATGGTGGG - Intronic
1146332220 17:31937083-31937105 AGGGAGGAGGAGAGGAGGGAAGG - Exonic
1146371768 17:32268931-32268953 AAGGTGACAGTGAGGATGGACGG + Intronic
1146688406 17:34856856-34856878 ATGGGGGTGGGGAGGATGGAGGG + Intergenic
1146779707 17:35658352-35658374 ATGGAGTAGGTGGGGAAGAAGGG - Intronic
1148089319 17:45013336-45013358 AAAGAGAAAGTGAGGAGGGAGGG - Intergenic
1148205430 17:45776817-45776839 AGGGAAAAGGAGAGGAGGGAAGG + Intergenic
1148512503 17:48184478-48184500 ATTGAGAAGGGGAGGAATGAAGG + Intronic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149024872 17:52016046-52016068 TTGGAGAAGGGTGGGATGGATGG + Intronic
1149031865 17:52092629-52092651 ATGGAGGTGGGAAGGATGGAGGG - Intronic
1149200704 17:54182876-54182898 AGTGAGAAAGTGAGGGTGGAGGG - Intergenic
1149374668 17:56031985-56032007 GTGCAGGAGGTGAGGATGGTGGG + Intergenic
1150101806 17:62430612-62430634 ATCTAGAATGTGAGGAAGGAAGG - Intronic
1150202277 17:63369920-63369942 GTAGGGAAGGTAAGGATGGAGGG - Intronic
1150645714 17:66976404-66976426 ATGGAGGTGGGAAGGATGGAGGG - Intronic
1150918496 17:69459945-69459967 AGGGAGAAGGAAAGGAAGGAAGG - Intronic
1151632813 17:75322495-75322517 AGGAAGAAGGTGAGGAGGGCTGG + Intronic
1152508759 17:80771308-80771330 AGGGAGAGCGTGAGGAAGGAGGG - Intronic
1152658763 17:81532755-81532777 ATGGTGATGGTGGTGATGGAGGG + Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1152796536 17:82310379-82310401 ATGGAGGAGATGAGGAGGGGAGG + Intergenic
1152850290 17:82629952-82629974 TGGGAGGAGGTGAGGAGGGAAGG - Intronic
1153362095 18:4208788-4208810 AGGGAGAAGGAGAGGTTGGGGGG + Intronic
1153502634 18:5764774-5764796 AAGGAGAAGGAGAGAATGAAAGG + Intergenic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1153997377 18:10454358-10454380 GAGGAGGAGGGGAGGATGGAAGG + Intergenic
1154024052 18:10690219-10690241 AGGGAGAAGGAGAGGTTGTAGGG + Intronic
1154032718 18:10767498-10767520 ATGGGGCAGGTGGGGATGCAGGG + Intronic
1154339698 18:13492763-13492785 ATGGAGAAAATGAGGAAGGGGGG - Intronic
1154375084 18:13802471-13802493 ATGGAGAAGCTGAGGTTTGGTGG - Intergenic
1155608325 18:27633572-27633594 AGGGGAAAGGTGAGGCTGGAAGG - Intergenic
1155721521 18:29018889-29018911 ATCGAAAAGGTGAGGAAAGAGGG - Intergenic
1155797382 18:30057563-30057585 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155797396 18:30057663-30057685 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156032554 18:32729230-32729252 ATGGGGAGGGTGAGGATGGCAGG + Intronic
1156399163 18:36725153-36725175 AGGGAGGAAGTGATGATGGAAGG - Intronic
1156503235 18:37572950-37572972 AGGGAGAGGCTGAGGATGGAGGG + Intergenic
1156508920 18:37618587-37618609 ATATAGAAGTCGAGGATGGAAGG - Intergenic
1156737778 18:40282401-40282423 ACTCAGAAGGTGAAGATGGAGGG + Intergenic
1156907399 18:42370307-42370329 ATGGAGGAGGTGAGGCATGAAGG + Intergenic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157134034 18:45036702-45036724 ATGGAGAATAGGAGGAAGGAAGG + Intronic
1157153803 18:45245100-45245122 CAGGAAAAGGTTAGGATGGAAGG - Intronic
1157328164 18:46684086-46684108 ATGATGACGATGAGGATGGAAGG + Intronic
1157403602 18:47405770-47405792 AGGGAGAAGGTGAGGCAGGGAGG + Intergenic
1157554623 18:48605386-48605408 ATGGAGAAGGAGGGGATATAAGG - Intronic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1158432117 18:57398696-57398718 AGGGAGTAGTTGAGGAGGGATGG + Intergenic
1158443897 18:57502099-57502121 ATGGAAAAGGAGAGGAGGAAAGG + Intergenic
1158506075 18:58046296-58046318 ATGGAGAAGTAGAGGATGCAAGG - Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158875305 18:61728553-61728575 ATGGAGAATGGAGGGATGGAAGG + Intergenic
1158924820 18:62245091-62245113 AAAGAGAAGGTGAGGAGGAAAGG - Intronic
1159150632 18:64518742-64518764 AAGGAGAAGGAAAGGAAGGAGGG - Intergenic
1159238746 18:65713065-65713087 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
1159325984 18:66918370-66918392 AGGGAGGAGGGAAGGATGGAAGG - Intergenic
1159418812 18:68188125-68188147 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1161329081 19:3677926-3677948 ATGGAGAATGGAGGGATGGAGGG + Intronic
1161329201 19:3678354-3678376 ATGGAGGAATGGAGGATGGAGGG + Intronic
1161329219 19:3678436-3678458 ATGGAGAGATGGAGGATGGAGGG + Intronic
1162127418 19:8506914-8506936 ATAGAGAAGGTGAGGCTAGGAGG - Intergenic
1162185596 19:8902180-8902202 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162185974 19:8905027-8905049 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162186700 19:8910460-8910482 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162187310 19:8915597-8915619 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162188151 19:8923016-8923038 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1163202315 19:15777968-15777990 GTGGAGAAGGTGGGGATGCCAGG + Intergenic
1163217830 19:15894015-15894037 ATGGAGGATGTGAGGAGGCAGGG - Intronic
1163246447 19:16097927-16097949 TTGCAGAAGTTCAGGATGGACGG - Intronic
1163445887 19:17346282-17346304 TTGGAGAAGGGATGGATGGAGGG + Intergenic
1163487136 19:17594660-17594682 ATGGAGGAGTGGAGCATGGAAGG - Intergenic
1164528674 19:29030376-29030398 ATGGTGATGGTGATGATGGTGGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1164787463 19:30944825-30944847 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1164937098 19:32223457-32223479 AGGAAGAAAGAGAGGATGGAAGG + Intergenic
1165808371 19:38595938-38595960 ATGGTGATGGTGTTGATGGATGG - Exonic
1165833740 19:38742543-38742565 CAGGATTAGGTGAGGATGGAAGG + Intronic
1165844728 19:38810841-38810863 ATGAAGAAAATGAGGAGGGAAGG - Intronic
1165847388 19:38827042-38827064 AGGGAGAAGGAGGGGAAGGAGGG + Intronic
1165912358 19:39237130-39237152 AGGGAGAAGGAGAAGATGAAGGG + Intergenic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166327997 19:42062894-42062916 ATGGGGAAGGAGAGGAGGCAGGG - Intronic
1166422941 19:42652676-42652698 AAGGAGTTGATGAGGATGGAAGG - Intronic
1166734693 19:45077082-45077104 ATGGTGGAGCTGAGGCTGGAGGG + Intergenic
1166778147 19:45324628-45324650 AGGAAGAAGATGAGGTTGGAGGG + Intergenic
1167195197 19:48023465-48023487 ATGGAGGAAGGGAGGAGGGAAGG + Intronic
1167410906 19:49343217-49343239 AAGGTGGAGGTGAGGCTGGAGGG - Exonic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167856883 19:52249058-52249080 ATGTAGAAGGTTTGGGTGGATGG + Intergenic
1168020673 19:53606643-53606665 GTGGAGGCGGTGAGGGTGGAGGG + Intergenic
1168649939 19:58086432-58086454 AAGAAGAAGGCGAGGCTGGAAGG + Intronic
924988141 2:288974-288996 ATGGGGAAGGTGGGGAGGGAAGG - Intergenic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925290169 2:2742609-2742631 AGGAAGAAAGGGAGGATGGATGG + Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
926132395 2:10312169-10312191 ATGGTGATGGTGATGATGGTGGG - Intronic
926399989 2:12487342-12487364 AGGGAGGAAGGGAGGATGGAAGG + Intergenic
926425903 2:12738480-12738502 GCAGAGAAGGTGAGGAGGGATGG - Intronic
926433869 2:12818361-12818383 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
926614164 2:14978744-14978766 ATGGAAAAGGTGTGAATGGGAGG - Intergenic
926765715 2:16321312-16321334 ATGGCGGGGGTGAGGAAGGAAGG + Intergenic
926838375 2:17050109-17050131 ACTGAGAAGGTGATGTTGGATGG - Intergenic
926850172 2:17187942-17187964 ATGAATAAACTGAGGATGGAAGG + Intergenic
926938548 2:18112001-18112023 ATGGAGAAGATAAAGATGGGAGG + Intronic
926974050 2:18495497-18495519 AAGGGGAAGGGGAGGAAGGAAGG - Intergenic
927272803 2:21231531-21231553 ATGGAGAGAGGGAGGATGTAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927371556 2:22361468-22361490 ATGGGGATGGTGATGATGGTGGG - Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927864308 2:26578895-26578917 ATGGTGATGGTGCTGATGGAGGG - Intronic
927897054 2:26789634-26789656 ATGGGGAAGCTGAGGATGAAGGG - Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928519302 2:32072736-32072758 TTTCAGAAGATGAGGATGGAGGG + Intronic
928999501 2:37332120-37332142 ATGGGAATGGTGAGTATGGAGGG + Intergenic
929172957 2:38949585-38949607 ATGGAGAAGAGAGGGATGGAAGG + Intronic
929769784 2:44881903-44881925 ATGGATAAGGAAAGAATGGAAGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
931939996 2:67241521-67241543 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
932091230 2:68808102-68808124 CTGGAGAAGGTGGGGAGGAAGGG - Intronic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
932719779 2:74130675-74130697 ACAGAGAAGGTGGAGATGGAGGG - Exonic
932722590 2:74148470-74148492 ATGGTCCAGGTGAGAATGGAGGG + Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933121057 2:78539004-78539026 CTGGAGAAGGAAATGATGGAAGG + Intergenic
933416727 2:81995852-81995874 ATGGGGATGGGGAGGATGAATGG - Intergenic
933450150 2:82438799-82438821 ATGGAGAAGGGGAGAAGGAAGGG - Intergenic
933712238 2:85334974-85334996 ATAGGGAAAGTGAGAATGGAGGG + Intergenic
933865866 2:86516855-86516877 AAGGAGAAGGTGGAGATGGGAGG + Intronic
933912741 2:86957719-86957741 ATTGTGAAGGTGAAGATGGATGG + Exonic
934010254 2:87812171-87812193 ATTGTGAAGGTGAAGATGGATGG - Exonic
934637805 2:96007044-96007066 ATGGGGAGGGGGAGAATGGAAGG - Intergenic
934795855 2:97098367-97098389 ATGGGGAGGGGGAGAATGGAAGG + Intergenic
935131311 2:100263148-100263170 GAAGAGAAGGAGAGGATGGAAGG - Intergenic
935626318 2:105175019-105175041 ATGGAGAGGGAGAGGCTGGTAGG - Intergenic
935651645 2:105387183-105387205 AGGGAGAAGGGGAAGATGCAAGG - Intronic
935773818 2:106452891-106452913 ATTGTGAAGGTGAAGATGGATGG - Exonic
935895375 2:107731564-107731586 ATGGAGAAGGTGAGTAGCAATGG + Intergenic
935906245 2:107843022-107843044 ATTGTGAAGGTGAAGATGGATGG + Exonic
935992712 2:108735545-108735567 ATTGTGAAGGTGAAGATGGATGG + Exonic
936128028 2:109808187-109808209 ATTGTGAAGGTGAAGATGGATGG + Exonic
936216669 2:110563298-110563320 ATTGTGAAGGTGAAGATGGATGG - Exonic
936425808 2:112417879-112417901 ATTGTGAAGGTGAAGATGGATGG - Exonic
936461684 2:112718932-112718954 ATGGAGGAATGGAGGATGGATGG - Intergenic
936503100 2:113082024-113082046 GTGGAGCTGGTGAGGGTGGATGG + Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936844641 2:116816142-116816164 AGGAAGAAAGGGAGGATGGAAGG + Intergenic
936878523 2:117221427-117221449 ATGGAGAAGGTATGGATGAAGGG + Intergenic
936912034 2:117603434-117603456 ATAGAGCAGGTGCGGATGGAGGG - Intergenic
936956983 2:118032391-118032413 ATGGACGAAGTGATGATGGATGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937662147 2:124443566-124443588 ATGGAGGAAGTGAGGAAGGGAGG + Intronic
937836132 2:126471949-126471971 ATGGGGAAGATGAGGATGGGGGG - Intergenic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
937934882 2:127235320-127235342 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
938108131 2:128547066-128547088 ATGGAGAATGGATGGATGGATGG - Intergenic
938245256 2:129771796-129771818 ATGGAGAAGGTAAGTATATAAGG - Intergenic
938273677 2:129997300-129997322 AGGGAGAATGTGAGAAAGGAAGG + Intergenic
938442534 2:131348815-131348837 AGGGAGAATGTGAGAAAGGAAGG - Intronic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939005587 2:136783063-136783085 ATGAAGAAGATGAGCATGCATGG - Intronic
939322971 2:140648506-140648528 GTGGAGAATGTGAGGAGGGGTGG + Intronic
939349445 2:141015838-141015860 ATTGAGAAGGCCTGGATGGATGG - Exonic
939918603 2:148080126-148080148 AAGGTGAAGGTGATGTTGGAAGG + Intronic
940139953 2:150483044-150483066 ATGGAGAAAGGGAGAAAGGAAGG + Intronic
940527147 2:154830960-154830982 ATTTAGAAGGTGAGGAAGGCTGG - Intronic
940697653 2:156999846-156999868 CTTGAGAAGGTGAGAATAGATGG + Intergenic
940905012 2:159161082-159161104 ATGGAGCAGCTGAGGATGGCTGG - Intronic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
941203229 2:162540821-162540843 ATAGAGGAGGCCAGGATGGAAGG + Intronic
941466067 2:165828674-165828696 TTTGGGAAGGTGAGGAAGGAGGG - Intergenic
942211803 2:173678393-173678415 AAGGAGGAGGGGAGGAAGGAAGG + Intergenic
942238451 2:173935972-173935994 AGGGAGAAAGTAAGGAAGGAAGG - Intronic
942342018 2:174958532-174958554 TTGGAGAAGGTGAGAAAGAAAGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943732303 2:191315207-191315229 AGGGAGGAGGGGAAGATGGATGG - Intronic
943766270 2:191665682-191665704 ATAGAGAAGGAGATGATGGTGGG + Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
944927428 2:204479493-204479515 TTAGTGAAGGTGAGGATGGGGGG - Intergenic
945907991 2:215615572-215615594 ATGCAGCAGAAGAGGATGGAAGG - Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946462501 2:219881645-219881667 ATAGAGGAGGTGAGGTGGGATGG - Intergenic
947192541 2:227522703-227522725 ATGAAGTAGGTGAGGAAAGAAGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
947910790 2:233799523-233799545 ATGGAGCAGCCGAGGTTGGAAGG + Intronic
947958225 2:234213104-234213126 ATGGAGAGGGGGAGGGTGCATGG + Intergenic
948068087 2:235097119-235097141 ATGGAGAGGCTGAGCAGGGAGGG + Intergenic
948068416 2:235100265-235100287 CTGGAGTAAGTGAGAATGGAGGG - Intergenic
948349937 2:237331375-237331397 TAGGAGAAGGTGAGGAGGGGAGG + Intronic
948369628 2:237480453-237480475 AAGGTGAAGGTGAGGATTCACGG + Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1169867632 20:10218273-10218295 ATGGAGCTGGCGAGGGTGGACGG + Intergenic
1169918239 20:10705383-10705405 ATGGGGACAGTGGGGATGGATGG + Intergenic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1170658165 20:18309924-18309946 ACAGAGAAGGAGAGGATGTAGGG + Intronic
1170984992 20:21249545-21249567 ATGGGGATGGTGATGATGGCAGG - Intergenic
1171084545 20:22225473-22225495 GTGGAAATGGGGAGGATGGATGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172012781 20:31856116-31856138 ATGGTTAAGCTGAGGATGGTGGG + Intronic
1172013070 20:31857708-31857730 ATGGTTAAGCTGAGGATGGTGGG - Intronic
1172043635 20:32063610-32063632 TTAGAGTAGGTGAGGATGGGAGG - Intronic
1172052984 20:32133467-32133489 ATGGAGCAGGTGAGAAAGGGAGG - Intronic
1172648957 20:36489712-36489734 GGGGAGAAGGTAAGGATGGGAGG + Intronic
1172720788 20:36999452-36999474 AGGGAGAGGGAGAGGAGGGAGGG - Intronic
1172791845 20:37511299-37511321 AGGGAGAAGGTGTGGAGGGAGGG - Intronic
1173185034 20:40834024-40834046 ATGGAGGAGGTGAAGAGAGAGGG + Intergenic
1173364048 20:42369140-42369162 AGTGAGAAAGGGAGGATGGATGG - Intronic
1173373534 20:42461427-42461449 CTGGAGAGGGTGAGGTGGGAGGG + Intronic
1173413127 20:42832363-42832385 GTGGAGAGGGAGAGGAGGGAGGG + Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173704041 20:45097082-45097104 ATGAAGAAGCTGAGGTTGAAGGG - Intronic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174097097 20:48098064-48098086 AGGAAGAAGGTGAGGGTAGATGG + Intergenic
1174568035 20:51481075-51481097 TTGTAGGAGGGGAGGATGGAGGG - Intronic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1174767459 20:53267350-53267372 AGGGAGAGGGAGAGCATGGATGG + Intronic
1174960546 20:55151847-55151869 ATGTAAAAGATGAGGAGGGAGGG - Intergenic
1175385680 20:58593507-58593529 ATGAAGAAGGGATGGATGGATGG + Intergenic
1175413253 20:58785215-58785237 AGGGAGAGGGTGAAGATGGTGGG - Intergenic
1175461716 20:59156646-59156668 ATGGGGAAGGTGAGGGTCAAAGG - Intergenic
1175615091 20:60391034-60391056 GTGGACAAAGTGAGGATAGAGGG + Intergenic
1175636400 20:60587742-60587764 AAGTAGAAGGTATGGATGGATGG + Intergenic
1175933494 20:62504432-62504454 ATGGTGATGGTGATGATGGTGGG - Intergenic
1175934848 20:62509858-62509880 GTGGAGCAGTGGAGGATGGAGGG - Intergenic
1175935019 20:62510337-62510359 TTGGAGAGGTGGAGGATGGAGGG - Intergenic
1175935026 20:62510360-62510382 ATGGAGGGGTGGAGGATGGAGGG - Intergenic
1175935063 20:62510451-62510473 GTGGAGAGGTGGAGGATGGAGGG - Intergenic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1175935172 20:62510745-62510767 ATGGAGAGGTGGAGGATGGAGGG - Intergenic
1175962952 20:62646269-62646291 AGGGTGAAGGTGAGGAGGCAGGG - Intronic
1175984072 20:62755472-62755494 ATGGAGGGAGGGAGGATGGATGG - Intronic
1175984106 20:62755573-62755595 ATGGAGGGAGGGAGGATGGATGG - Intronic
1175984142 20:62755674-62755696 ATGGAGGGAGGGAGGATGGATGG - Intronic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1176618812 21:9041781-9041803 GAGGAGAAGGTGAGGTTTGAGGG - Intergenic
1176707181 21:10125376-10125398 AAGGGGAAGGTGAGGTTTGAGGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178202430 21:30422650-30422672 TTGGAGCAGGTGGGGAGGGATGG + Intronic
1178389084 21:32184059-32184081 AGGGAGAGGGTGAGGCTGAATGG - Intergenic
1178928079 21:36792448-36792470 AAGGAGAAGGGGGGGAGGGAAGG + Intronic
1179030033 21:37712489-37712511 GAGGAGAAGGGGAGGAGGGAGGG - Intronic
1179030053 21:37712548-37712570 GAGGAGAAGGGGAGGAGGGAGGG - Intronic
1179030079 21:37712629-37712651 GAGGAGAAGGGGAGGAGGGAGGG - Intronic
1179030093 21:37712674-37712696 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179030106 21:37712719-37712741 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179137541 21:38693413-38693435 ATGGAGATGAAGAGGATGGATGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179238455 21:39567658-39567680 AGGAAGAAGGAGAGGATGGTGGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179482412 21:41686550-41686572 ATGGAAAAAGGGAGGAAGGAAGG + Intergenic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179927104 21:44540753-44540775 AGGGAGAAGGGGAGCAAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180930786 22:19589567-19589589 ATGGAGAAGGGATTGATGGAAGG - Intergenic
1181009446 22:20031999-20032021 ATGGGCAAGGTGAGCCTGGAGGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181080747 22:20413222-20413244 AAGGGGAAGGGGAGGAGGGAGGG + Intergenic
1181528317 22:23502381-23502403 ATGGGGGATGAGAGGATGGAGGG - Intergenic
1181901023 22:26155916-26155938 AGGGAGAAAGGGAGGAAGGAGGG + Intergenic
1182029774 22:27148876-27148898 ATTGAGAAGGTCATGATGGCAGG - Intergenic
1182086704 22:27565790-27565812 AGGGAGAAAGGAAGGATGGATGG + Intergenic
1182287429 22:29256671-29256693 ATGGGGTAGGGGAGCATGGAAGG + Intronic
1182769134 22:32781076-32781098 AGGGAGGAAGGGAGGATGGAAGG - Intronic
1183081679 22:35460740-35460762 CTGCAGAAGGTTAGGAAGGAAGG + Intergenic
1183093444 22:35539063-35539085 ATGGGGCAGGTGGGGGTGGAGGG - Intergenic
1183274587 22:36885658-36885680 ATGGGGAAGGAGAGGAGGGCGGG - Intergenic
1183284661 22:36954265-36954287 TTGGGGCAGGTGAGGAAGGATGG - Intergenic
1183509559 22:38226979-38227001 AAGGAGACGGAGAGGACGGAGGG + Intronic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1183698813 22:39438208-39438230 AGGGAGAAGGGAAGGAAGGAGGG - Intergenic
1183718287 22:39547093-39547115 ATGGAGAGGGAGAGGAGGCAGGG + Intergenic
1183951001 22:41353184-41353206 ATGGCGAAGATCAGGAGGGATGG - Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184835705 22:47019803-47019825 AGGGAGAAGCGAAGGATGGAGGG - Intronic
949714599 3:6914858-6914880 ATAGAGATGGGGAGGATTGAGGG - Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950360811 3:12448305-12448327 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950646566 3:14380852-14380874 AGGGAGCAGGGGAGGAAGGAAGG + Intergenic
950723232 3:14899302-14899324 ATGGAGCAGTGGAGGATGGGAGG - Intronic
950907583 3:16553046-16553068 GGGGAGAAGGGGAGGAGGGAGGG + Intergenic
950965039 3:17140155-17140177 CTGCAGAAGGTGAGGATGCTGGG + Intergenic
951280625 3:20744738-20744760 ATTGTAAAGGAGAGGATGGAGGG - Intergenic
951746662 3:25985779-25985801 ATGGAGAAGTTGAGAATTTAAGG + Intergenic
952174068 3:30842547-30842569 ATGGAGAAAGGGAGGAAGGAAGG + Intronic
952542340 3:34379501-34379523 AGGAAGAAGGTGAGGAGGGAAGG - Intergenic
952855492 3:37767100-37767122 AGGGAGGAGGGGAGGATGCAGGG + Intronic
952878771 3:37969972-37969994 ATGGAGCAGGTGAGAATGGCAGG - Intronic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953340984 3:42134147-42134169 AAGGGGAAGGGGAGGAAGGAAGG - Intronic
953388928 3:42523344-42523366 ATGGTGAAGGAGAGGAGGGGAGG - Intronic
953392907 3:42544168-42544190 AAGGAGAAAGTGAGGATAGAAGG - Intergenic
953410101 3:42685958-42685980 ACGCAGATGGTGAAGATGGAAGG - Exonic
953455023 3:43034227-43034249 AGGGAGAAAGTGAGGATGCTTGG + Intronic
953980720 3:47411678-47411700 ATGGAGAAGGTGAGAAGAGGGGG + Exonic
954178729 3:48864830-48864852 ATGGAGATGGTGTGAAGGGATGG + Intronic
954447181 3:50553102-50553124 AAAGAGAAGGTGAAGATGAAGGG + Intergenic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955822866 3:62914781-62914803 AGGGAATAGGTGAGGATTGAAGG + Intergenic
956106291 3:65822166-65822188 ATGAGGAAGGTCAGGAAGGAGGG + Intronic
956758842 3:72419377-72419399 ATGGATAAGGGGAGAAAGGAAGG + Intronic
957563303 3:81854051-81854073 ATGGAAAAGGGGATGAGGGATGG + Intergenic
958479449 3:94628091-94628113 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
959082596 3:101817690-101817712 ATGGATGAGGTAAGGAAGGAGGG + Intronic
959215261 3:103444140-103444162 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
960865478 3:122195050-122195072 ATGGAGAAGGGAGGGATGGAGGG - Intronic
960926110 3:122795898-122795920 ATGGGGATGTTGAGGATGAAAGG + Intronic
960944895 3:122959055-122959077 ATGAAGAAACTGAGGATGGGAGG + Intronic
961660260 3:128464890-128464912 AAGGAGAAAGGGAGGAAGGAAGG - Intronic
962490875 3:135893002-135893024 AGGGAGAAAGTAAGGAAGGAAGG + Intergenic
962559534 3:136591261-136591283 AGGGAGGAGGGGAGGAGGGAAGG + Intronic
962575835 3:136753933-136753955 AAGGAGAAGGTGGGAAGGGATGG - Intergenic
962627443 3:137239880-137239902 ATGGAGAAAGAGAGGAAGGTGGG + Intergenic
962685597 3:137844955-137844977 AGGGAGAGGGAGAGGATGGATGG - Intergenic
962812129 3:138968600-138968622 AAGGAGAGGGAGAGGAGGGAGGG + Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
963257238 3:143157993-143158015 TTGAAGAAGGTGAGGAAGAAAGG - Intergenic
963320892 3:143807900-143807922 ATGGAGAAGGTGCCGGTAGAGGG + Intronic
963405397 3:144856681-144856703 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
963566107 3:146933028-146933050 ATTGTGAAGGTGAGTATTGATGG - Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
964810398 3:160657263-160657285 ATGGAGAAGGGGGGCTTGGAAGG - Intergenic
965317021 3:167204977-167204999 ATGGAGAAGATGAGAAGAGAAGG + Intergenic
965339944 3:167477651-167477673 GTGGAGAAGGCGGTGATGGAAGG - Intronic
965467205 3:169044849-169044871 ATGCAGGAGATGAGGAGGGAAGG + Intergenic
966005232 3:175002923-175002945 ATGGAAAGAGTGAGGATGCAAGG - Intronic
966261807 3:177987307-177987329 AAGGAGCAGGTGAGCAGGGAAGG - Intergenic
966567470 3:181398893-181398915 ATGGAAAAATTGATGATGGATGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967205198 3:187113109-187113131 AGGGTGAAGGTGGGAATGGATGG + Intergenic
967645362 3:191916674-191916696 ATGGAGAAGTTGAGGAGATAAGG - Intergenic
967882399 3:194311082-194311104 ATGGTGGTGGTGAGGATGGATGG + Intergenic
968296476 3:197580913-197580935 ATGGAGAAGGCCAGGATGCAAGG - Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968598368 4:1496905-1496927 ATGGATAGGTAGAGGATGGATGG + Intergenic
968912063 4:3481410-3481432 ATGGACAAGGGGAGGAGGGCCGG + Intronic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969030122 4:4205146-4205168 CAGGGGATGGTGAGGATGGAAGG - Intronic
969102583 4:4780473-4780495 ATGGAGAAACTGAGGCTTGAGGG - Intergenic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
969612208 4:8233704-8233726 ATGGATAATGGAAGGATGGATGG - Intronic
969612219 4:8233762-8233784 ATGGATAATGGAAGGATGGATGG - Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970310973 4:14782149-14782171 ACTGAGTAGGTGAGGAAGGAAGG + Intergenic
970689970 4:18611600-18611622 AAGGAGAAAGGGAGGAAGGAAGG + Intergenic
970690134 4:18612060-18612082 AAGGAGAAAGGGAGGAAGGAAGG + Intergenic
970690220 4:18612298-18612320 AAGGAGAAAGGGAGGAAGGAAGG + Intergenic
971296506 4:25398362-25398384 ACTGAGAAGGTGAAGTTGGAAGG + Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
972316963 4:37935774-37935796 ATGGCGAAGGTAAGACTGGAGGG - Intronic
972330323 4:38058126-38058148 AGGGAGGCGGTCAGGATGGAAGG - Intronic
972410455 4:38788222-38788244 ATAGAGAAAATTAGGATGGAAGG + Intergenic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975512775 4:75211706-75211728 ATGTAGAAATTGAGGAGGGAAGG - Intergenic
975612055 4:76213413-76213435 ATCGAGAAGGTGAGGCGGGGCGG - Exonic
975696663 4:77020752-77020774 ATTGAGATGGTGATGATGGAAGG + Intronic
975962981 4:79935297-79935319 ATGGAGAGGGTGGGGGTGGGGGG - Intronic
976587280 4:86812742-86812764 AAGGAGGAGGTGAGGTTAGAGGG + Intronic
976697027 4:87927716-87927738 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
977271763 4:94925956-94925978 AGGGAGGAGGGGAGGAAGGAAGG - Intronic
977293911 4:95191711-95191733 AGGGAGGAGGTGAGCAGGGAAGG - Intronic
977294128 4:95192598-95192620 GGGGAGAAGGTGAGCAGGGAAGG - Intronic
977955593 4:103021901-103021923 ATGGAGAGGATCTGGATGGATGG - Intronic
978725271 4:111962235-111962257 ATTGAGAAGGGGAAGATGGTGGG - Intergenic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
979170492 4:117595868-117595890 ATGGGGAAGGTGAGGATTTCAGG + Intergenic
980842732 4:138285471-138285493 ATGGAAGAGGTGAGGATGAAAGG - Intergenic
981538841 4:145827303-145827325 ATAGAGAAGGGGGTGATGGAGGG + Intronic
982199644 4:152947829-152947851 AGAGAGAAGGGAAGGATGGAAGG + Intronic
982317669 4:154047949-154047971 ATGGAGCTGGTCAGGATGGTAGG + Intergenic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
983121058 4:163885207-163885229 ATGCATTTGGTGAGGATGGATGG + Intronic
983274275 4:165598701-165598723 ATGGGGAAATTGAGGAAGGAAGG - Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
985117435 4:186605552-186605574 ATGGAGAAGAGGTGGAGGGAGGG + Intronic
985166098 4:187095728-187095750 AGGGAGAAGGTGAGGCTGCAGGG + Intergenic
985312441 4:188616991-188617013 ATGAAGAAGATTAAGATGGAAGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986001147 5:3631795-3631817 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
986007318 5:3678721-3678743 GAGGAGAAGGTGGTGATGGAGGG - Intergenic
986015193 5:3751522-3751544 AGGGAGAAAGAAAGGATGGAGGG + Intergenic
986051396 5:4093816-4093838 ACGGGGATGGTGAGGAAGGATGG - Intergenic
986105774 5:4658116-4658138 AGGCAGAAGGGGAGGATGGAGGG - Intergenic
986468366 5:8049962-8049984 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
986468443 5:8050296-8050318 AAGGAGAAGGGAAGGAAGGAGGG + Intergenic
986501130 5:8401032-8401054 CTTGAGCAGGTGAAGATGGATGG + Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
987148131 5:15012446-15012468 TTGGGGAAGTGGAGGATGGAGGG + Intergenic
987384692 5:17318265-17318287 ATGGACAAGGGATGGATGGACGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987579807 5:19775179-19775201 ATGGTGAAGATGAGGATGCTTGG + Intronic
988592990 5:32565190-32565212 GGGGAGAAGGTGGGGATGGCAGG + Intronic
988977206 5:36527090-36527112 ATGGAAAATGTGAGGAAGGGGGG + Intergenic
989210195 5:38851486-38851508 AAGGAGATGGGGAGGAAGGAAGG + Intronic
989311947 5:40029605-40029627 ATGGAAGAGGTTAGGATGCAAGG + Intergenic
989428437 5:41323785-41323807 ATGTAGAAGGAGAGGAAGAAAGG + Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990895757 5:60699152-60699174 ATGGAAGAGGTGAGGATGCTGGG - Intronic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991035403 5:62123074-62123096 GTGGAGAAGATCAGGATGGAGGG + Intergenic
991105368 5:62836799-62836821 AAAGAAAAGGTGAGGATGGGAGG + Intergenic
991166127 5:63566707-63566729 ATTGAGAACTTGAGGATGCAGGG + Intergenic
992462643 5:76976118-76976140 AAAGAGAGGGTGAGGATGGGTGG - Intronic
992915612 5:81450017-81450039 AATGAGAAGCGGAGGATGGATGG - Intronic
993111132 5:83658773-83658795 AGGGAGAGGGTTAGCATGGATGG - Intronic
993439349 5:87936755-87936777 AGGGAGAGGGGGAGGAGGGAAGG - Intergenic
993979895 5:94532470-94532492 ATGGAGGAAGGGAGGAAGGAAGG - Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
994198860 5:96949926-96949948 ATGGAAAAGGAAAGGAGGGAGGG - Intronic
994981842 5:106885167-106885189 ATGGAAATGGTGAGGAGGGGAGG + Intergenic
995130918 5:108629620-108629642 AGGGAGAAGGTCTGGGTGGAAGG + Intergenic
995904439 5:117106522-117106544 ATGGAGAGATTGAGCATGGATGG + Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996914504 5:128695988-128696010 AGGGAGACTGTGAGGCTGGAAGG - Intronic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
997607056 5:135182704-135182726 AGGGGGAAGGTGAGGAAGGGTGG + Intronic
998499038 5:142616004-142616026 CTGGAGAAGGTGGAGATGCATGG - Intronic
998531632 5:142890439-142890461 TGGGAGGAGGTGAGGCTGGAGGG + Intronic
999125917 5:149245664-149245686 ATGGAGAAAGAGAGGATGTGGGG + Intronic
999476812 5:151907808-151907830 ATGGAGAAGATGACCTTGGAAGG + Intronic
999622888 5:153490441-153490463 GAGGATAAGGTGAGGATGGGAGG + Intronic
999728012 5:154453018-154453040 ATTTAAAAGGTGAGAATGGATGG - Intronic
1000052515 5:157575341-157575363 AAGGAGAAGGCGAGAAGGGAAGG + Intronic
1000725997 5:164771626-164771648 AGGGAAAGGGTGAAGATGGAGGG - Intergenic
1000828045 5:166070538-166070560 TTGGAGGAGGTGAGGGTAGATGG - Intergenic
1000840511 5:166212208-166212230 ATGGTACAGCTGAGGATGGATGG - Intergenic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001284388 5:170411921-170411943 ATGGAGAGAGAGAGGTTGGAGGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001751430 5:174134515-174134537 ATGGATAATGAGTGGATGGATGG - Intronic
1001825733 5:174743427-174743449 ATGGAGAAAGGAAGGAAGGAAGG - Intergenic
1002031353 5:176433028-176433050 AGGGAGAGGGAGAGGAGGGAGGG - Intergenic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002289817 5:178192639-178192661 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1002382669 5:178841380-178841402 TTGGAGAAGGAGAGGAAGAAGGG - Intergenic
1003347625 6:5285306-5285328 AGGGAGAAGGGGAGGAAGGCAGG + Intronic
1003348483 6:5293428-5293450 GGGGAGGAGGTGGGGATGGAGGG + Intronic
1003373661 6:5553247-5553269 CAGGAGTAGATGAGGATGGATGG + Intronic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003857112 6:10287592-10287614 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004642113 6:17525545-17525567 ATGCAGCCGCTGAGGATGGAAGG - Intronic
1004764069 6:18704643-18704665 ATGGTGGAGGGGAGGATGGAGGG - Intergenic
1004842867 6:19606680-19606702 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1005581875 6:27242880-27242902 AAGGAAAAGGCAAGGATGGAGGG + Intergenic
1005980802 6:30835140-30835162 ATGGAGAAGGTGGGTAGTGATGG + Intergenic
1005995472 6:30928461-30928483 AGTGAGAAGGGGAGGATGGTGGG + Intergenic
1006090611 6:31626568-31626590 AAAGAGTAGGGGAGGATGGATGG + Intronic
1006106741 6:31721411-31721433 TTGGAGGTGGGGAGGATGGATGG + Intronic
1006876611 6:37303024-37303046 ATGGAGAAGGAAAGGAAGCAAGG + Intronic
1006929663 6:37680160-37680182 AAGGCAAAGGTGGGGATGGAAGG + Intronic
1006934066 6:37705357-37705379 AAGGAGAAGGGGAGGAGGGGCGG + Intergenic
1007125519 6:39422759-39422781 AGGGAGTAAGTGAGGAGGGAGGG - Intronic
1007262705 6:40575047-40575069 ATGGAGGAAGTGAGGATGTGAGG + Intronic
1007485656 6:42178972-42178994 AAGGAGAGGGTGAGGAAGGGAGG + Intronic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007735281 6:43978445-43978467 AAAGAGAAGATAAGGATGGAGGG - Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1007940517 6:45776416-45776438 GTGGGGAAGGTGAGGAGGGTTGG - Intergenic
1008422849 6:51322389-51322411 ATTTAGAAGGTGAGGATAGGAGG - Intergenic
1009690486 6:67025904-67025926 TTGGAGTTGGTGAGGATGTATGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010118435 6:72342969-72342991 ATGGAGAGAGTGAGGATATAGGG + Intronic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011621008 6:89242612-89242634 ATGGAAAAGGGAAGGAAGGAAGG + Intergenic
1011632371 6:89339616-89339638 AGGGGGAAGGGGAGGAGGGAAGG + Intronic
1011963081 6:93115931-93115953 ATGGAAAGGGTCTGGATGGATGG + Intergenic
1013170958 6:107635811-107635833 TTGGAGAAGAGGAGGATGGGGGG + Intronic
1013987013 6:116206656-116206678 ATGGAGCAGGGTAGGAGGGATGG - Intronic
1014225925 6:118846791-118846813 AAGGTGATGGTGAGGTTGGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015265078 6:131283352-131283374 ATGGAGTAGATCATGATGGAGGG + Exonic
1015732231 6:136360890-136360912 ATGGAGAAGGTGTGGAAAGCGGG + Intronic
1015836531 6:137426240-137426262 TTGTAGAAGATGAGAATGGAAGG + Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1016022284 6:139248723-139248745 TCGGAGAAGGTGAGCATGGCAGG + Intronic
1016646271 6:146412065-146412087 AGGCAGAAGGAGGGGATGGAGGG - Intronic
1016823544 6:148367712-148367734 ATGGAGTTGGTGGGGATGGACGG + Intronic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017027425 6:150193608-150193630 TGGGAGAAGGGGAGGAGGGAGGG + Intronic
1017032994 6:150240678-150240700 ATGCAGAAAGTGAGGAGGGTTGG + Intronic
1017300556 6:152852723-152852745 ATGGAGAAGGGAAGAAGGGAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017721189 6:157244213-157244235 AGGGGGAAGGAGAGGAGGGAAGG - Intergenic
1017821713 6:158053836-158053858 CAGGTGAATGTGAGGATGGATGG - Intronic
1017983750 6:159424809-159424831 ATGGAGAAGATGAGGCTGTTTGG - Intergenic
1018086657 6:160306862-160306884 ATGAAGAAAGAAAGGATGGAAGG + Intergenic
1018392602 6:163351848-163351870 GTGGAGCAGGTGTGCATGGAAGG - Intergenic
1018432212 6:163731072-163731094 ATGGTGAGGGCCAGGATGGAGGG + Intergenic
1018781914 6:167076086-167076108 AGGGAGGAAGGGAGGATGGAAGG - Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019230317 6:170554785-170554807 ATGGAGAAGAAGCGGATGGCAGG - Intronic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019860717 7:3656189-3656211 AAGGAGAAGGGAAGGATGGAGGG - Intronic
1020240396 7:6390010-6390032 AAGGAGTAGGAGAGGAGGGAAGG - Intronic
1020441160 7:8218300-8218322 ATGGAGAAGTTCAGGAAGGTAGG - Exonic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020562586 7:9748121-9748143 ACAGAGAAGGCGAGGAAGGATGG - Intergenic
1021116707 7:16753523-16753545 CAGGAGCAGGTGAGGAGGGAGGG - Exonic
1021450614 7:20780353-20780375 AGAGAGAAGGTGAGGAAGGAAGG + Intergenic
1021612620 7:22472925-22472947 ATGGAGAGGATGATGATGGCGGG + Intronic
1021656703 7:22880643-22880665 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1021658283 7:22893518-22893540 ATGGACAAGGTGTGGAAAGATGG - Intergenic
1021670083 7:23026824-23026846 ATGGGGAAGGAGAGGATACATGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022194731 7:28053849-28053871 GTGGGAAAGGTGAGGATGGAAGG - Intronic
1022244992 7:28550601-28550623 GCGGAGAAGGTGAGGAAGTAAGG - Intronic
1023694698 7:42832916-42832938 ATGGAGAAGGTGAATATGAAAGG + Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024368903 7:48558130-48558152 ATGGAGAAAGGAAGGAAGGAAGG - Intronic
1024439754 7:49403678-49403700 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1025922740 7:65928754-65928776 GTGGAGAGGGTGAGGATTGCTGG + Intronic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026178223 7:68016366-68016388 AAGGAGAAAGGAAGGATGGATGG - Intergenic
1026181676 7:68046770-68046792 CTGGAGAAGGGGAGGAGGAAAGG + Intergenic
1026284282 7:68949570-68949592 ATGGAGAAGGGGGGTATGGGAGG - Intergenic
1026319697 7:69257983-69258005 ATGGTGAATGAGTGGATGGATGG + Intergenic
1026405047 7:70056389-70056411 AGGGTGAAGGTGATGAAGGAGGG - Intronic
1027159769 7:75793785-75793807 AAGGGGAAGGGGAGGAAGGAAGG + Intergenic
1027572074 7:79882186-79882208 ATGGAGAAGGAGGGGAAGAAGGG - Intergenic
1027733600 7:81905289-81905311 ATGGAGAAAGGTAGGAAGGAAGG - Intergenic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1027986992 7:85305743-85305765 AAGAAGAAGGTAATGATGGATGG - Intergenic
1028119139 7:87037509-87037531 ATGGAGAGGGAGAGAATAGATGG - Intronic
1028665520 7:93338990-93339012 ATGTGGAAGGTGAGGAAGAAGGG + Intronic
1028882987 7:95900732-95900754 TTTGAGAAAGAGAGGATGGATGG - Intronic
1029117482 7:98244747-98244769 CTGGGGAAGGTGGGGAGGGAGGG + Intronic
1029375396 7:100174279-100174301 AGGCAGAAGGTGAGGCTGGGAGG + Intronic
1029412822 7:100426798-100426820 AAGGAGAGGGGGAGGAGGGAGGG - Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029685833 7:102147317-102147339 ATGGGGAAGGGGAGGAGGGGAGG - Intronic
1029888924 7:103905907-103905929 ATAGAGGAGGTAAGTATGGAAGG + Intronic
1030301306 7:107977113-107977135 ATGGAGAAGGAAGGGAGGGAGGG - Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030617174 7:111750172-111750194 ATGGTAAAGGTAAGGATGGGAGG + Intronic
1031995207 7:128226250-128226272 ATGGATGATGGGAGGATGGATGG - Intergenic
1031995268 7:128226487-128226509 ATGGACAATAGGAGGATGGAAGG - Intergenic
1031995273 7:128226510-128226532 ATGGACAATAGGAGGATGGAAGG - Intergenic
1032512043 7:132480204-132480226 AAGGAAAAGGTAAGAATGGAGGG + Intronic
1032577523 7:133071369-133071391 AAAGAGAAGGTGGGGAGGGAAGG + Intronic
1032685672 7:134231563-134231585 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1032685719 7:134231699-134231721 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1032685728 7:134231731-134231753 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1033056278 7:138057896-138057918 ATGCAGAAGTAGTGGATGGAAGG - Intronic
1033204817 7:139409638-139409660 AGGGAGAAGCTGAGGAGGTATGG + Exonic
1033322603 7:140353511-140353533 ATGGGGAAGGTGGGGTAGGAAGG - Intronic
1033446331 7:141425541-141425563 ATGCAGAAGGGAAGGATGAAAGG - Intronic
1033582784 7:142752056-142752078 CTGGAAATTGTGAGGATGGAGGG - Intronic
1033584341 7:142762976-142762998 CTGGAAATTGTGAGGATGGAGGG - Intronic
1033652675 7:143354478-143354500 TTGGAGAAGGTGAGGAACCAGGG + Exonic
1034293195 7:149948515-149948537 ATGGAGAGGGTGGGGCAGGAAGG - Intergenic
1034534900 7:151720644-151720666 ATGAAGGAGGAGAGAATGGAGGG + Intronic
1034551907 7:151826130-151826152 ATGGAGAAAGAGAGAATGGATGG - Intronic
1034812879 7:154148364-154148386 ATGGAGAGGGTGGGGCAGGAAGG + Intronic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1035342425 7:158172462-158172484 ATGGTGAGGGTGATGATGGTAGG - Intronic
1035342457 7:158172666-158172688 ATGGTGAAGATGATGATGGTGGG - Intronic
1035342476 7:158172782-158172804 ATGGTGAAGATGATGATGGTGGG - Intronic
1035342485 7:158172835-158172857 ATGGTGAAGTTGATGATGGTGGG - Intronic
1035342706 7:158174376-158174398 ATGGTGAAGATGATGATGGTGGG - Intronic
1035618252 8:1018201-1018223 AGGGACAAGCTGAGGACGGAGGG - Intergenic
1035716517 8:1759386-1759408 ACGGAGAGGGTGAGAACGGACGG + Intronic
1035721467 8:1796518-1796540 ATGGAGGAAGTTAGGAAGGAAGG - Intergenic
1035732101 8:1860452-1860474 ATGGAGAGGAGGAGGAGGGAAGG - Intronic
1036627551 8:10484073-10484095 CAGGAGAAGGTGAGGAGTGATGG - Intergenic
1036718064 8:11144986-11145008 ATGGAGAAAGGGAGAAGGGAGGG + Intronic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037346285 8:17904868-17904890 CTGCAGAAGGTAATGATGGATGG + Intronic
1038180351 8:25221640-25221662 ATGGAGATGATGATGATGGTAGG - Intronic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038598519 8:28913424-28913446 ATGGTGAAGGCGAGGTGGGAGGG - Intronic
1038680091 8:29658778-29658800 ATGGAGGGGGTGAGGATGGAAGG - Intergenic
1039196367 8:35035929-35035951 AGGGAGATTGTGATGATGGATGG + Intergenic
1039223173 8:35357876-35357898 ATGAAGGAAGGGAGGATGGAAGG - Intronic
1039347192 8:36719150-36719172 AGGGAGAAAGGAAGGATGGAAGG - Intergenic
1039845195 8:41321022-41321044 AGGCTGAAGGTGAGGAAGGAGGG - Intergenic
1041213958 8:55581333-55581355 ATGGGGAATATGAGGATGAATGG + Intergenic
1041669103 8:60475354-60475376 AAGGAGAAGGAGAGGAGGTAAGG - Intergenic
1041689098 8:60671940-60671962 GGGGAAAAAGTGAGGATGGAAGG - Intergenic
1042028093 8:64445265-64445287 AAGGAGAAAAGGAGGATGGAAGG - Intergenic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042810604 8:72821809-72821831 AAGGTGAAGGGAAGGATGGAGGG + Intronic
1043084360 8:75810600-75810622 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1043119402 8:76303724-76303746 ATGGAGAAAGGGAGGAAGGAAGG + Intergenic
1043826647 8:84937444-84937466 ATGGAGAAGGTGAGGAGCTCAGG - Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044152207 8:88795302-88795324 TTAGGGATGGTGAGGATGGAAGG + Intergenic
1044213847 8:89583965-89583987 AAGAAGAAGGTGAGAATGGATGG - Intergenic
1045526765 8:102947195-102947217 ATAGATAATGTAAGGATGGATGG - Intronic
1045755113 8:105533701-105533723 AGGGAGAAAGTAAGGAGGGAGGG - Intronic
1045755159 8:105533848-105533870 AGGGAGAAAGGGAGGAAGGAAGG - Intronic
1046389574 8:113552093-113552115 ATGGATATGGTGGTGATGGAGGG + Intergenic
1046573002 8:115990716-115990738 ATTGAGAAAGAGAGGAGGGAAGG + Intergenic
1046756106 8:117974383-117974405 ATGGAGCAGATGAGGAAGCATGG - Intronic
1046877652 8:119274197-119274219 GTGGGGAATGTGAGGATAGAGGG + Intergenic
1047306883 8:123659620-123659642 ATGGAGAATGGATGGATGGATGG - Intergenic
1047791669 8:128209788-128209810 ATGTTGAAGGTGAGGATTGGTGG - Intergenic
1047971212 8:130086188-130086210 GTGGAGAGGGTGAGGAGGGCTGG + Intronic
1048026211 8:130589319-130589341 ATGGAGAATGAGGAGATGGAGGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048366199 8:133740762-133740784 ATGGAGAACATAAGGAGGGATGG + Intergenic
1048439230 8:134447734-134447756 ACTGAGAAGGAGAGGATGGTGGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048982603 8:139711041-139711063 ATGGAGAAGCTGGGGATGCTGGG - Intergenic
1049258476 8:141626256-141626278 ATGAGGAAGGGGTGGATGGATGG + Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1049464572 8:142744955-142744977 ATGGATAAGTGGGGGATGGATGG + Intergenic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049533322 8:143167143-143167165 AGGGAGAAAGTGGGGAGGGAAGG + Intergenic
1049583162 8:143421786-143421808 AGGGAGAAGCTGGGGATGGGTGG + Intronic
1049589724 8:143451928-143451950 GCGGAGAAGGTGCTGATGGAAGG + Intronic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050788927 9:9441500-9441522 AGGCAAAAGGTGATGATGGAGGG + Intronic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051596801 9:18832196-18832218 CTGGGGAAGTTCAGGATGGAAGG - Intronic
1051666860 9:19474047-19474069 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
1051756337 9:20404931-20404953 ATGGAGGATCTGAGGAAGGAAGG - Intronic
1052711771 9:32065936-32065958 AGGCTGAAGCTGAGGATGGAAGG - Intergenic
1053137858 9:35662906-35662928 ATGGGGCAGTTGAGGATTGAAGG + Intronic
1053290868 9:36878983-36879005 ATGCAGAAGGAAAGAATGGAGGG + Intronic
1056099540 9:83287578-83287600 ATGGTGAAGGTGAGGTAGAAAGG - Intronic
1056238542 9:84620258-84620280 ATGAAGATGATGAGGATGGTGGG + Intergenic
1056856350 9:90132908-90132930 CTTGAGAAGCTGAGGATGTAGGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057602850 9:96473501-96473523 TTGGCGTAGGTGAGGATGCAGGG - Intronic
1057851906 9:98572555-98572577 ATGGTGAAGGGGTGGATGGGTGG - Intronic
1057961095 9:99457826-99457848 AGGGAGAAGGGAAGGAAGGAGGG + Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058390703 9:104492022-104492044 ATGGAGCAAGGGAGGAAGGAAGG + Intergenic
1058447323 9:105065635-105065657 AAGAAGAAGGTGAGAATTGAAGG - Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058634501 9:107023364-107023386 AGGGAGCTGGTGAGGGTGGATGG + Intergenic
1058823417 9:108753740-108753762 ATGGAGACTGGGATGATGGATGG - Intergenic
1058890173 9:109354620-109354642 ATTAAGAAGGTGAGAACGGAAGG - Intergenic
1058944228 9:109841688-109841710 AGGGAAGAGGAGAGGATGGAGGG + Intronic
1059053950 9:110959265-110959287 ACAGAGAAGGTAAGGATGGAAGG + Intronic
1059151507 9:111953581-111953603 ATGGAGAAGGGGAGAAAGTATGG - Intergenic
1059653109 9:116333856-116333878 ATGGTGATGGTGGGGGTGGAGGG - Intronic
1060006804 9:120007816-120007838 AAGGAGAAAGGGAGGAAGGAAGG + Intergenic
1060176824 9:121503355-121503377 ATGGAGAATCTGAGGAAGAAAGG - Intergenic
1060206405 9:121685143-121685165 ATGGAGGGAGTGAGGGTGGAGGG - Intronic
1060266631 9:122115464-122115486 ATGGAGCAGGCTAGGATGGGTGG - Intergenic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060748014 9:126150470-126150492 ATGGATAATGGGTGGATGGAGGG + Intergenic
1061375720 9:130223151-130223173 ATGGATAAGGTGAGGTGGGGGGG + Exonic
1061783010 9:133006921-133006943 ATGGTGGATGTGTGGATGGATGG + Intergenic
1061853547 9:133429430-133429452 ATGGAGGAGGGTAGGATGCAGGG - Intronic
1061868662 9:133508355-133508377 ATGAAGAAAGTAAGGAAGGAAGG - Intergenic
1061926619 9:133809026-133809048 ATTGAGAAGGTGAGGGCAGATGG - Exonic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1062480916 9:136750965-136750987 AGGGAGGAGGGGAGGAAGGAGGG + Intergenic
1202791927 9_KI270719v1_random:94250-94272 AAGGGGAAGGTGAGGTTTGAGGG + Intergenic
1203726758 Un_GL000216v2:56069-56091 ATGGAGAGGAAGAGAATGGAAGG - Intergenic
1185762674 X:2700624-2700646 ATGGAGAATGGATGGATGGATGG - Intronic
1185843663 X:3417053-3417075 AAGGAGAAAGGGAGGAAGGAAGG - Intergenic
1185933315 X:4227741-4227763 AAGGAGAAAGTAAGGAAGGAAGG - Intergenic
1185972595 X:4681867-4681889 AGGAAGAAGGAGAGGAGGGAAGG + Intergenic
1186000972 X:5010077-5010099 ATGGAGAGGTTGAGAAAGGAAGG + Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186133655 X:6496211-6496233 ATGGAGAAGGTGGGGAGAAAGGG - Intergenic
1186250307 X:7658824-7658846 ATGGACAAGACCAGGATGGACGG - Intergenic
1186574093 X:10746997-10747019 ATGGAGAAGGTGAGAGGTGATGG + Intronic
1187176144 X:16897915-16897937 ATGGAGAGAGTGAGGCTGGAGGG + Intergenic
1187277736 X:17831004-17831026 GTAGAAAAGATGAGGATGGATGG - Intronic
1187488619 X:19728459-19728481 ATGCAGTAGGTGAGAATGGGTGG + Intronic
1187547211 X:20266367-20266389 GAGGTGAGGGTGAGGATGGAAGG + Intronic
1187700857 X:21963260-21963282 AGGAGGAAGGTGAGGATGAAGGG + Intronic
1188485177 X:30674527-30674549 AAGGAGAATGAGGGGATGGATGG - Intronic
1188596413 X:31906803-31906825 AAGTAGAAGGTGAGGTTGGAGGG - Intronic
1188711195 X:33401198-33401220 ATGGAGAGAGTGAAGAGGGAAGG + Intergenic
1189110697 X:38286386-38286408 AAGGAGAAGGGGAGGAAGAAGGG - Exonic
1189219482 X:39358916-39358938 TAGAGGAAGGTGAGGATGGAAGG - Intergenic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189236236 X:39489450-39489472 ATGGGAAAGCTGATGATGGAGGG - Intergenic
1189374226 X:40454054-40454076 ATTAACAAGGTGAGGAAGGAAGG - Intergenic
1190185323 X:48228626-48228648 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190190722 X:48274694-48274716 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190644261 X:52510255-52510277 ATGGAGAGGGGGAGGAAGGAAGG - Intergenic
1190664860 X:52687299-52687321 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190674562 X:52771120-52771142 ATGGTGATGGTGAGGCTGGAAGG - Intronic
1190856261 X:54297784-54297806 AAGGAGAAGGTCAGGCTCGATGG + Intronic
1191864896 X:65696054-65696076 ATGGGGAAGGTGAGGAGACAAGG - Intronic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192779173 X:74276906-74276928 ATGGACAAAGTGATCATGGAAGG + Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1194861979 X:99010709-99010731 AGGGAGAAGGGAAGGAAGGAAGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196738357 X:119000896-119000918 AAGGAGGAGGAGAGGAGGGAGGG - Intronic
1196852426 X:119950089-119950111 AGGGAGAGGGTAAGGAAGGAAGG - Intergenic
1197821345 X:130543931-130543953 TTGGAGAAGCTGAGAATGTAGGG + Intergenic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198215954 X:134554976-134554998 ATAAAGAAGGTGTGGCTGGAGGG - Intergenic
1198225373 X:134640468-134640490 AAGGAGAAGGGAAGGACGGAAGG - Intronic
1198317059 X:135478382-135478404 AAGGAGAGGTTGAGGATAGAGGG - Intergenic
1198484260 X:137070842-137070864 AGGGAGAAGGAGAGGAGGAATGG - Intergenic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic
1200253106 X:154564277-154564299 AGAGGGAAGGGGAGGATGGAGGG - Intronic
1200264661 X:154640138-154640160 AGAGGGAAGGGGAGGATGGAGGG + Intergenic
1200615787 Y:5378655-5378677 ATTGAGATGGTGAGCATGGCAGG + Intronic
1201146417 Y:11067491-11067513 AGGGAGAGGGTGAGGAAGGGAGG + Intergenic
1201146430 Y:11067535-11067557 AGGGAGAGGGTGAGGAAGGAAGG + Intergenic
1201298448 Y:12485767-12485789 AAGAATAAGGTGAGGAAGGAGGG - Intergenic
1201479007 Y:14417100-14417122 TTTCAGAAGGTGAGGATGGGAGG + Intergenic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic
1202273903 Y:23096279-23096301 GGGGAGAAGGGGAGGAGGGAGGG + Intergenic
1202292123 Y:23324398-23324420 GGGGAGAAGGGGAGGAGGGAGGG - Intergenic
1202426899 Y:24730024-24730046 GGGGAGAAGGGGAGGAGGGAGGG + Intergenic
1202443892 Y:24940070-24940092 GGGGAGAAGGGGAGGAGGGAGGG - Intergenic