ID: 1018884944

View in Genome Browser
Species Human (GRCh38)
Location 6:167927462-167927484
Sequence CTAAATCCTGCATTTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018884944_1018884948 26 Left 1018884944 6:167927462-167927484 CCACAAAGAAATGCAGGATTTAG 0: 1
1: 0
2: 2
3: 26
4: 305
Right 1018884948 6:167927511-167927533 ACATTTTAGGAGGCTTCATCTGG No data
1018884944_1018884949 27 Left 1018884944 6:167927462-167927484 CCACAAAGAAATGCAGGATTTAG 0: 1
1: 0
2: 2
3: 26
4: 305
Right 1018884949 6:167927512-167927534 CATTTTAGGAGGCTTCATCTGGG No data
1018884944_1018884947 16 Left 1018884944 6:167927462-167927484 CCACAAAGAAATGCAGGATTTAG 0: 1
1: 0
2: 2
3: 26
4: 305
Right 1018884947 6:167927501-167927523 GATGAAACTGACATTTTAGGAGG No data
1018884944_1018884946 13 Left 1018884944 6:167927462-167927484 CCACAAAGAAATGCAGGATTTAG 0: 1
1: 0
2: 2
3: 26
4: 305
Right 1018884946 6:167927498-167927520 CATGATGAAACTGACATTTTAGG 0: 1
1: 0
2: 5
3: 52
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018884944 Original CRISPR CTAAATCCTGCATTTCTTTG TGG (reversed) Intronic
901135058 1:6987745-6987767 CTAAATCCTGTAGGTCGTTGAGG + Intronic
903073532 1:20743203-20743225 CTAGATTCTACATTTATTTGTGG - Exonic
905497726 1:38407138-38407160 CAAAATCCAGCATTGCTTTATGG + Intergenic
907265433 1:53257125-53257147 CTGAATACTGCATATCTTTGAGG - Intronic
907746604 1:57219846-57219868 CTCAATGCTGCCTTTCTTTCCGG - Intronic
908310636 1:62878905-62878927 CTAAATTTTGGATTTGTTTGTGG + Intergenic
910559577 1:88576156-88576178 CTAGATTCTGCAGCTCTTTGCGG - Intergenic
910810608 1:91231856-91231878 CTAAATCCTGAATTACTTCATGG + Intergenic
910845025 1:91596380-91596402 CTGAACCCTGCATATCTCTGAGG - Intergenic
912370746 1:109172318-109172340 CTAACTCCTGCCCTACTTTGAGG + Intronic
913340106 1:117750329-117750351 CTAAATCCTGTTGTTCTTTTAGG + Intergenic
916385528 1:164263334-164263356 CAAAATCCTGGATTTCTGTGAGG - Intergenic
916669653 1:167003072-167003094 ACAACTCCTGCATCTCTTTGGGG + Intronic
919559380 1:199098114-199098136 TTAAAACCTGGATATCTTTGGGG - Intergenic
920042177 1:203107258-203107280 CTCTCTCTTGCATTTCTTTGGGG + Intronic
921674318 1:217961552-217961574 CTAAATTTTTTATTTCTTTGGGG - Intergenic
922847400 1:228698102-228698124 ACAGATCATGCATTTCTTTGAGG + Intergenic
924298472 1:242612624-242612646 CCACTTCCTGCATTTCATTGTGG + Intergenic
1063271170 10:4511255-4511277 CTAAATCATGCATTCCTTTCTGG - Intergenic
1063698098 10:8357149-8357171 CTGGATCCTGCCTTTCTTTTGGG + Intergenic
1065578568 10:27148832-27148854 CTTAATCCTTCATTTGTTTAAGG + Intronic
1067140358 10:43651012-43651034 TTAAATCCAGCACTTCTGTGTGG + Intergenic
1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG + Intergenic
1068540210 10:58284168-58284190 CTAATTTCTGCATTTTTTTGTGG - Intronic
1072348581 10:94534543-94534565 GGAAATCATGCATTTCTTGGCGG - Exonic
1072776390 10:98200182-98200204 TGAAATCCTGCATTCTTTTGAGG + Intronic
1073911181 10:108346639-108346661 ATAAATACAGCATTTCTCTGTGG - Intergenic
1074255286 10:111796266-111796288 CAGAATTCTGCATTTCTTTCTGG + Intergenic
1075292941 10:121245865-121245887 CTCAATCCTCCAGTTCTTAGTGG - Intergenic
1078817307 11:14838658-14838680 TTAAATCCTGCAGATCTTAGGGG + Intronic
1079818734 11:25096141-25096163 CTACATCCTGCATGTCATGGAGG + Intergenic
1080271141 11:30451961-30451983 CTACTTCCCACATTTCTTTGAGG - Intronic
1081433122 11:42998320-42998342 CTAATTCTTACATATCTTTGAGG - Intergenic
1082624610 11:55467786-55467808 CTAAATCCTGTCTTCCATTGTGG - Intergenic
1082712443 11:56569642-56569664 CTATTTCCTGCAGTTTTTTGGGG + Intergenic
1082954437 11:58854300-58854322 CTAAACCCTCCATATCTCTGAGG - Intronic
1083099957 11:60292834-60292856 TTTAATCCTTCATTTCTTTTGGG - Intronic
1084744404 11:71159505-71159527 CTAGAACCTGAATATCTTTGGGG + Intronic
1084771372 11:71344769-71344791 TTAGATCCTGCATTTATTTTAGG + Intergenic
1085453425 11:76652358-76652380 CTAAAACCTGCATTTCTGGTAGG + Intergenic
1085748799 11:79140804-79140826 CTAAATCCTGTTTTCATTTGTGG - Intronic
1089097558 11:115931793-115931815 CTGAATCCTACCATTCTTTGAGG + Intergenic
1089437368 11:118481838-118481860 CTCACTACTGCTTTTCTTTGGGG - Exonic
1090700841 11:129294175-129294197 CTAATTTTTGTATTTCTTTGTGG - Intergenic
1090856339 11:130612157-130612179 CTACTTCCTTCATTTCTTTCAGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1091941613 12:4488967-4488989 CTACCTCTTGCATTTTTTTGCGG - Exonic
1091992341 12:4965569-4965591 CTAAAACCTGCATTTTTAAGGGG - Intergenic
1092137950 12:6162699-6162721 CTAAACCCTGCTTTTCTTATGGG - Intergenic
1093290805 12:17319230-17319252 CAAAATCCAGCATTGCTTTATGG - Intergenic
1093674041 12:21913660-21913682 CTTCATTTTGCATTTCTTTGAGG - Intronic
1093820685 12:23614166-23614188 CTTCATCCTGCACTTCCTTGAGG - Intronic
1094002863 12:25715158-25715180 CTAAATCCAGCATCTTTATGAGG - Intergenic
1094469041 12:30785785-30785807 CTCAATTATGCATTTGTTTGGGG + Intergenic
1095344705 12:41136382-41136404 CTTAATTCTGCATCTCTCTGTGG - Intergenic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096031432 12:48419179-48419201 AAAAAGCCTGCATTTCTTTAGGG - Intergenic
1096381553 12:51162670-51162692 CGAAATCCTGATTTTTTTTGTGG + Intronic
1098509000 12:71289998-71290020 CAGAAATCTGCATTTCTTTGGGG + Intronic
1098599089 12:72308165-72308187 CTAGCTCCTGCATTTCTCGGTGG + Intronic
1098896555 12:76069423-76069445 AGAAATGCTGTATTTCTTTGAGG + Intronic
1100134454 12:91538073-91538095 CTAAATCCTGCATGTCTCCCTGG + Intergenic
1100225582 12:92552607-92552629 CTCAATCCTGCTTATCTTTTTGG + Intergenic
1100411571 12:94324251-94324273 CCAAATGAGGCATTTCTTTGTGG + Intronic
1100471675 12:94899280-94899302 CTAGATCCTTCATTTCATTAGGG - Intronic
1100482165 12:94989637-94989659 TTCAAAGCTGCATTTCTTTGTGG - Intronic
1102223447 12:111210629-111210651 CTAATTTTTGCATTTTTTTGGGG - Intronic
1103842169 12:123873968-123873990 CTAAATTCAGCATGTATTTGAGG + Intronic
1104392241 12:128400772-128400794 CTAATTTTTGCATTTTTTTGTGG + Intronic
1106285382 13:28314030-28314052 CTAATTCTTGTATTTTTTTGTGG - Intronic
1106353926 13:28960929-28960951 TTATATCATCCATTTCTTTGTGG - Intronic
1107140782 13:36996818-36996840 CTAAATGCTTTATTTCATTGCGG - Intronic
1107691642 13:42959327-42959349 CTACATCATGCATTTCTTTGTGG - Intronic
1108919759 13:55659753-55659775 GTAAGTCCTGCTTTTCTATGGGG - Intergenic
1109498378 13:63205882-63205904 CTGAATCCTGCTTTTCTTGATGG - Intergenic
1109746763 13:66633886-66633908 CTTAATCCTGCAGTTCTTGCAGG + Intronic
1109753648 13:66729264-66729286 TTTAATCCTCCATTTCTTTGAGG + Intronic
1110170241 13:72491849-72491871 ATAAATTCTGCTTTTGTTTGGGG - Intergenic
1110602825 13:77395608-77395630 CTAATTCTTGTATTTTTTTGTGG - Intergenic
1110819623 13:79899408-79899430 CAAGATCCTGCATTTTTTTCAGG + Intergenic
1112837736 13:103536340-103536362 CGAAAGCCTGCATTTCCTTTGGG - Intergenic
1113338789 13:109402142-109402164 CTAAATCCTGCAGGTCTTCGAGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114802044 14:25786995-25787017 ATAAATCCTTCATGTCTCTGTGG + Intergenic
1114865444 14:26588012-26588034 TCAAATCCTGCATTTCTTCTAGG - Intronic
1115901081 14:38148909-38148931 CTAAAGCCAGGAATTCTTTGTGG - Intergenic
1117205479 14:53438385-53438407 TTAAAGCCTGCATTTCATTTGGG - Intergenic
1117744066 14:58849869-58849891 CTGTATCCTGGATTGCTTTGAGG - Intergenic
1120502549 14:85314595-85314617 CTAACTCCTTCATTTCTTTCAGG - Intergenic
1120571777 14:86127279-86127301 CAAAATCCTTGATTTCTCTGGGG - Intergenic
1124185458 15:27523651-27523673 TTATATCCTCTATTTCTTTGTGG - Intronic
1125612916 15:40984396-40984418 CCAAATCCCGCTTTTCTTTTGGG - Intronic
1127386909 15:58474350-58474372 CTAAATTTTGTATTTTTTTGTGG - Intronic
1128244272 15:66122409-66122431 CGAAGTCCTGGTTTTCTTTGAGG - Intronic
1128963630 15:72035376-72035398 TTAAATCCTTCATTTGTTGGTGG - Intronic
1130038837 15:80386697-80386719 ATAAAACCTGCATTTCATTGCGG - Intronic
1130049540 15:80472192-80472214 TTAAATCCTCCATTACTTTTAGG - Intronic
1130131747 15:81149388-81149410 CTAAATCCTGCAGTACTTGATGG - Intergenic
1131477427 15:92752125-92752147 CTAAAGCCTTCCTTACTTTGGGG + Intronic
1131775856 15:95797755-95797777 CTAAATCTTCCATTTCCTGGAGG - Intergenic
1131816456 15:96226113-96226135 CTAAGTCCTGCATGTCATTCTGG - Intergenic
1132088801 15:98930526-98930548 CTAAAGCCTGTGTTTCCTTGGGG - Intronic
1132533743 16:467123-467145 CTAGCTCCTGCCTTACTTTGTGG - Intronic
1132890166 16:2199833-2199855 GTAGCTCCTGCATTTCTGTGGGG - Intergenic
1133601934 16:7348256-7348278 ATGTATCCTGGATTTCTTTGTGG + Intronic
1134311647 16:13080581-13080603 CTCAATCCTGCTCTTCTTTTAGG - Intronic
1135692756 16:24556576-24556598 CTACATCTTGCATTTCTGTGAGG + Intronic
1136735757 16:32465753-32465775 TTAAATCCAGTGTTTCTTTGTGG + Intergenic
1141295550 16:82765100-82765122 TTAAATCATTCATTTCTTTGTGG + Intronic
1141449020 16:84084589-84084611 ATATATCCTCCATTTCCTTGGGG - Intronic
1141669642 16:85485094-85485116 ATAAATCCTGCTTTTGTCTGTGG - Intergenic
1203017318 16_KI270728v1_random:363821-363843 TTAAATCCAGTGTTTCTTTGTGG - Intergenic
1203035653 16_KI270728v1_random:636979-637001 TTAAATCCAGTGTTTCTTTGTGG - Intergenic
1144096155 17:11902506-11902528 CTAAATCTTGCATGTTATTGGGG + Intronic
1147469166 17:40641894-40641916 CTTCACTCTGCATTTCTTTGAGG + Intronic
1149032948 17:52104366-52104388 CTAATTCTTGCATTTATTTGTGG + Intronic
1149284130 17:55143267-55143289 TTTAATCATGCATTTCTTTGGGG - Intronic
1149733947 17:58974672-58974694 CTAATTACTTCATTTCTTTAGGG - Intronic
1152463413 17:80452852-80452874 CTGAATCCTGCATTTAGTAGTGG + Intergenic
1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG + Intergenic
1153812082 18:8760865-8760887 CTCAATCCTTAATTTATTTGTGG - Intronic
1154108019 18:11541044-11541066 CTAAATCCTGAATTTTTTGTGGG + Intergenic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1154984593 18:21536973-21536995 TTAAATCCCACATTTCTTGGAGG + Intronic
1156058376 18:33039970-33039992 ATAAATCCTGGATTTTCTTGTGG - Intronic
1156778614 18:40823127-40823149 CTAAGTCCTATATTTCTTGGAGG - Intergenic
1156817295 18:41326578-41326600 CTGAATACTGGAATTCTTTGTGG + Intergenic
1157336169 18:46739141-46739163 CCAAATCCTGCTTCTCTTTCTGG - Intronic
1158664240 18:59418115-59418137 GTAAATCTATCATTTCTTTGGGG - Intergenic
1158886927 18:61837289-61837311 CTCAATCCTGGATCTCATTGTGG - Intronic
1161611461 19:5245452-5245474 CTAAATGTTTCATTTTTTTGTGG + Intronic
1162617653 19:11814765-11814787 CTAGATGCTGGTTTTCTTTGCGG - Intronic
1163014529 19:14446170-14446192 CTAATTTTTGCATTTTTTTGTGG + Intronic
1163965671 19:20745087-20745109 CAAATTCCTTCATTTCTCTGGGG + Intronic
1166518900 19:43466155-43466177 CTACATCCTGCATGCCCTTGAGG - Intergenic
1167672987 19:50866096-50866118 CTAAATCCTGAATTATTTTCTGG + Intronic
925369092 2:3330204-3330226 CTAACTCCTGCATTTAGCTGAGG - Intronic
926883701 2:17577541-17577563 ATAAATTCTGCATGTATTTGAGG + Intronic
928920490 2:36521820-36521842 TGAAATCCTGGTTTTCTTTGGGG - Intronic
929553625 2:42909973-42909995 CAAAATCCTGAATTTGTTTGGGG - Intergenic
929678477 2:43963671-43963693 CCAATTCTTGCATTCCTTTGAGG + Exonic
929848729 2:45560722-45560744 TTAAATCTAGCATTTCTTTTAGG + Intronic
929908601 2:46068938-46068960 GGAAATCCTGCATTTCTAAGAGG - Intronic
931036427 2:58249034-58249056 CTAATTCTTGTATTTTTTTGTGG + Intergenic
931556829 2:63515476-63515498 CTAAAAACTGCATTTGTGTGAGG + Intronic
932386914 2:71343400-71343422 CTAAATCCTGCATGCCACTGTGG - Intronic
932428802 2:71660771-71660793 TTAAATCTTGCATGTCTATGGGG + Intronic
932818156 2:74878072-74878094 CTAAATCTTGCATCACCTTGGGG - Intronic
933274622 2:80270265-80270287 CTAAATCCTCTATTTTTTTAGGG + Intronic
935981254 2:108630026-108630048 CTAATTTTTGTATTTCTTTGTGG - Intronic
937296600 2:120813275-120813297 CTAAGAGCTGCATTGCTTTGGGG + Intronic
937572589 2:123382007-123382029 CAAAATCCTGTACTTCTTGGAGG - Intergenic
938024167 2:127931083-127931105 ATAAATACTGCATTTCTCTGGGG - Intergenic
940362313 2:152809767-152809789 TTAAATCCAGTGTTTCTTTGTGG + Intergenic
941274781 2:163477765-163477787 CTAAATCCTAGATTTCTTTGGGG - Intergenic
941413960 2:165195323-165195345 CTGAATCCTCCATGTCCTTGAGG - Intronic
941582960 2:167322100-167322122 CCAGATCCTAAATTTCTTTGAGG - Intergenic
941731706 2:168925027-168925049 CTCATTTCTGCATTTCTTTTAGG + Intronic
941891721 2:170589131-170589153 CTAAACCCTGAATTTTCTTGGGG - Intronic
942529198 2:176890114-176890136 ATAAATCTTATATTTCTTTGTGG - Intergenic
942566309 2:177267558-177267580 CAAAATCCTCCATCACTTTGAGG + Intronic
943131273 2:183856008-183856030 CAAAATCCAGCATTCCTTTATGG + Intergenic
943978324 2:194511958-194511980 CCAATTCCTGCAGTTCTCTGAGG + Intergenic
944055611 2:195519300-195519322 CTAATTTCTCCATTTCTTTATGG - Intergenic
944110866 2:196130176-196130198 CTAAAACCTGCTCTTCTTAGGGG + Intergenic
946211818 2:218153284-218153306 CTCAACCCTTCATTTCTTTCAGG + Intergenic
946796951 2:223364619-223364641 CTGCATACAGCATTTCTTTGTGG - Intergenic
1169602908 20:7282672-7282694 CTAAATCCTGTTTTTCTTTATGG - Intergenic
1169826476 20:9774036-9774058 CCATATCCTGCTTTGCTTTGTGG - Intronic
1170415937 20:16141998-16142020 CATAATCCTTCATTTCTTTTGGG - Intergenic
1170918447 20:20652186-20652208 CTAAATCCTAAATTTCATTTAGG - Intronic
1171310815 20:24143361-24143383 GTTAATCCTGCTTTGCTTTGGGG + Intergenic
1172175341 20:32968960-32968982 CTCAATGCTGCAGTTCTTGGAGG + Intergenic
1172340132 20:34150944-34150966 CTAACCCCTCCTTTTCTTTGCGG - Intergenic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1174050508 20:47764224-47764246 CTAGCTCCTTTATTTCTTTGCGG + Intronic
1176103443 20:63374955-63374977 TAAAATCGTGCATCTCTTTGAGG - Intronic
1176693975 21:9950830-9950852 CTCATTTCTGCCTTTCTTTGAGG - Intergenic
1177283513 21:19017341-19017363 CTAAATTCTACAATTGTTTGTGG + Intergenic
1177571453 21:22892276-22892298 CAAAATCCAGCAATTCTTTCTGG - Intergenic
1178435070 21:32551037-32551059 CTAAGCACTGCATTTCTTTCAGG - Intergenic
1183110297 22:35643836-35643858 CTAATTTTTGCATTTTTTTGTGG + Intergenic
1184049264 22:41992023-41992045 CTAACCCCTGCATTTCATAGAGG - Intronic
1184573879 22:45346486-45346508 CCAACTCCTGGATTTCTCTGAGG + Intronic
1184965751 22:47970930-47970952 TTAAAATCTGCATTTCTCTGTGG + Intergenic
950879809 3:16314174-16314196 CCAAACCCTGTATGTCTTTGTGG + Intronic
951336867 3:21434214-21434236 CTAAATCATGCATTCCGTTTGGG + Intronic
951666360 3:25128112-25128134 TTAATTCCTGCTTTTCTTAGGGG + Intergenic
951690879 3:25395561-25395583 CATAATCCTACATTTCTTGGAGG + Intronic
952151073 3:30592481-30592503 CTATATCCTGCTGTTATTTGGGG + Intergenic
952262273 3:31751871-31751893 AGAAATCCTACATTTCTTTCAGG - Intronic
952676261 3:36034361-36034383 CTAAAACATTTATTTCTTTGTGG + Intergenic
953874744 3:46660276-46660298 CTGGTTCCTGCATTTCTTTCAGG - Intergenic
955560327 3:60182238-60182260 CTAAATCCTGCTTCTATTAGTGG + Intronic
956814229 3:72893369-72893391 CTAACTCCTCCATTTTTTTCAGG + Intronic
957708975 3:83828835-83828857 CTAAACCATGCATTTTTTTTTGG + Intergenic
958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG + Intergenic
958649007 3:96912537-96912559 CTAAATCCTACCTTTCCTTTAGG - Intronic
959382466 3:105658056-105658078 CTTATGCCTGCATTACTTTGAGG - Exonic
961206088 3:125083037-125083059 GTACATCCAGCATTTCTTTATGG - Exonic
962384452 3:134921514-134921536 CTAAACCATGAATTTCTCTGAGG + Intronic
963365033 3:144323716-144323738 CTAAATCCAGCAATTCTCAGAGG - Intergenic
964075964 3:152692242-152692264 CAAAATCCAGCATCTCTTTATGG + Intergenic
965183289 3:165432461-165432483 CAAAATCCAGCATTGCTTTATGG - Intergenic
966690007 3:182732280-182732302 TTAAAACCTGGATATCTTTGAGG - Intergenic
966799088 3:183745688-183745710 CTATATCCTGCATTTCTGACAGG + Intronic
967746549 3:193062222-193062244 CTACATCCTGCCTTTCTGTTTGG - Intergenic
968243695 3:197119174-197119196 ATTAATACTGCTTTTCTTTGAGG - Intronic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
969104224 4:4792974-4792996 CTAACTCTTCCATTTCCTTGTGG - Intergenic
970913358 4:21305072-21305094 TTAAATTCTGTATTTCATTGTGG - Intronic
971297020 4:25404012-25404034 CTAAATTTTGCATTTGTTGGAGG - Intronic
976003977 4:80406298-80406320 TGAAGTTCTGCATTTCTTTGTGG + Intronic
977163190 4:93662160-93662182 CTTACTCCTGCATTGCTTTCAGG + Intronic
977215458 4:94278042-94278064 GAAAATCCTTTATTTCTTTGTGG - Intronic
978357392 4:107891654-107891676 ATAAAACCTGCATTTCACTGAGG - Intronic
979398004 4:120211838-120211860 CTAATTTCAGCATTTCTATGGGG + Intergenic
979594356 4:122517669-122517691 TTAAATCTTTCATTTTTTTGAGG - Intergenic
979660735 4:123251705-123251727 CTAAGTCCTGTATTTGTTTTAGG + Intronic
980366596 4:131811028-131811050 CTAATTTCTGCCTTTCTTTGAGG - Intergenic
981037126 4:140183575-140183597 TTATATCCTGCTTTTATTTGTGG - Intergenic
981985611 4:150851210-150851232 CTAAATACTGCCTTTCTTTTAGG - Intronic
982791295 4:159594773-159594795 CAAAATCCAGCAATCCTTTGTGG + Intergenic
983541152 4:168912010-168912032 CTAAAACCTGGACTTCTTTAGGG - Intronic
983802863 4:171957084-171957106 CTAAATCCTGCACATCCTTCAGG + Intronic
985329984 4:188821463-188821485 CACGATCCTGCATTTCTTTCAGG - Intergenic
986788170 5:11134261-11134283 CTAAGGGCTGCATTTCCTTGTGG - Intronic
988296000 5:29363068-29363090 CTAAATGCTGCATTTGTTCAAGG - Intergenic
989236820 5:39157786-39157808 CACAATCCTGTCTTTCTTTGAGG - Intronic
990088364 5:52007622-52007644 ATCAATCCTACAGTTCTTTGGGG + Intergenic
990180685 5:53157072-53157094 CTAAATCCTGTAGCTCTTTTGGG + Intergenic
990863040 5:60349749-60349771 CTAAATCCTAAATCTTTTTGAGG + Intronic
990896314 5:60703373-60703395 GTAAAACCTCGATTTCTTTGAGG - Intergenic
992625669 5:78634020-78634042 CTGAATCCTGAATTACTTTATGG - Intronic
993201487 5:84821691-84821713 CTAAATTCTGCATTTTAATGTGG - Intergenic
994573258 5:101540897-101540919 CTAAATCTTGAATTTCAATGAGG - Intergenic
996297856 5:121944423-121944445 CTAAATTCTGCATTTTTATGAGG + Intergenic
996306341 5:122052409-122052431 CAAAATCCTATATTTCTTGGAGG + Intronic
996428231 5:123338722-123338744 CTAAATACTGCATATTTTTATGG + Intergenic
996476032 5:123921772-123921794 CTACATCCCTCATTTCTTTAGGG + Intergenic
996649560 5:125857033-125857055 CTTAGTTCTGAATTTCTTTGTGG - Intergenic
997572882 5:134946217-134946239 ATAAATCCTGAATATATTTGTGG + Intronic
999554629 5:152727210-152727232 CTAAATACTGCATGGCTTTATGG + Intergenic
999596489 5:153210928-153210950 TTAAATCCTTCCTGTCTTTGGGG + Intergenic
1000763844 5:165259926-165259948 CTCAAGCATGCATTTCTTTCAGG + Intergenic
1000990884 5:167910535-167910557 CTAGCATCTGCATTTCTTTGTGG + Intronic
1005446801 6:25932207-25932229 CTAATTTTTGCATTTTTTTGTGG - Intergenic
1006241729 6:32686842-32686864 TTATATTCTTCATTTCTTTGAGG + Intergenic
1006459685 6:34151124-34151146 CTAAATCCTACTTGTCTTTTAGG - Intronic
1006666114 6:35694739-35694761 CTCAATTGTGCAGTTCTTTGGGG + Intronic
1008002835 6:46378468-46378490 GTAAATCCTGAATTTCTCTCTGG - Intronic
1008195113 6:48509472-48509494 ATTAATCCTGTATCTCTTTGTGG + Intergenic
1008278502 6:49568221-49568243 CTCAATCATGCATTTATTTCTGG - Intergenic
1008860451 6:56142906-56142928 CTAAAAGCTTCATTTCTATGTGG + Intronic
1009697858 6:67133066-67133088 CTAAATTCAGCTTTTCTTTAAGG - Intergenic
1010294844 6:74183628-74183650 CAAGATCATGCATTTCTTTTAGG + Intergenic
1010914458 6:81598634-81598656 CTAAAAAATACATTTCTTTGAGG + Intronic
1011098791 6:83698091-83698113 CTATATTCTGCATTACTTTTGGG - Intronic
1011332607 6:86227004-86227026 CTTAGTCCAGTATTTCTTTGAGG + Intergenic
1011867562 6:91849601-91849623 CTAAATCCTTAATGTCTGTGAGG + Intergenic
1012079960 6:94744519-94744541 ATAAATATTGCATTTCCTTGGGG + Intergenic
1012341583 6:98131701-98131723 CTAAAGCCTTCATTGATTTGGGG - Intergenic
1013160228 6:107536517-107536539 CTCAATCCTTCATTTCTTTTTGG + Intronic
1013606669 6:111756446-111756468 CTATCTCCTGCATTTTTTTTTGG - Intronic
1013825521 6:114206006-114206028 CTAATTCCTGCATTTATTTCTGG + Intronic
1013841107 6:114395071-114395093 CAAAATACTGCATATATTTGAGG + Intergenic
1014007112 6:116431919-116431941 CTAAAAATTGCATTTCCTTGGGG - Intronic
1015500914 6:133932172-133932194 CGTAATCCTGTATTTCTTGGAGG - Intergenic
1015714527 6:136178695-136178717 CTAAAACATGCATTTCTATTTGG + Intronic
1017747225 6:157457812-157457834 CTCAATGCTGCATTTGGTTGAGG - Intronic
1018790874 6:167146830-167146852 CTAAATCCTGCTGTGCTCTGCGG - Intronic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1019862820 7:3676129-3676151 CTAAATTTTGTATTTTTTTGTGG + Intronic
1019862827 7:3676181-3676203 CTAAATTTTGTATTTTTTTGTGG + Intronic
1020762527 7:12286184-12286206 CTAATTCTTGTATTTTTTTGTGG + Intergenic
1020768869 7:12361728-12361750 ATGAATCATGCATTTCTTGGCGG + Intronic
1020920946 7:14263539-14263561 CTAAATCCTGCATATCTGTTAGG + Intronic
1026952790 7:74358733-74358755 CTAAATTTTGTATTTTTTTGTGG + Intronic
1027328655 7:77067903-77067925 CAAAATCCAGCATCTCTTTATGG - Intergenic
1028355982 7:89908938-89908960 CTACATCCTGCATCTCTCTGGGG - Intergenic
1029859800 7:103557885-103557907 TTAAATCCGTGATTTCTTTGTGG + Intronic
1031555042 7:123164239-123164261 CTAAATACAGAATTTATTTGGGG + Intronic
1032574322 7:133035928-133035950 CTGGATCCAGCCTTTCTTTGCGG - Intronic
1035067012 7:156113471-156113493 CTACATCCTGCAGTTCCTTTGGG + Intergenic
1037047858 8:14332110-14332132 TTTCATCCTGCATTTTTTTGTGG - Intronic
1037391220 8:18393791-18393813 CCAAATCCTGAATTTTTTTCTGG - Intronic
1037968766 8:23155898-23155920 CTATATCCTGACTTTCTTTAAGG - Intronic
1038210065 8:25509314-25509336 CTAATTCATTCATTTTTTTGGGG - Intergenic
1038374652 8:27027184-27027206 CTACATGTTGCATTTCTCTGTGG + Intergenic
1039270801 8:35877968-35877990 CTACCTCCTTGATTTCTTTGTGG + Intergenic
1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG + Intergenic
1041877873 8:62711739-62711761 GTAAATCATGCATTTCTTCTTGG + Intronic
1042478561 8:69278188-69278210 CAAAATCCTGCAATGCTTTTAGG - Intergenic
1044946475 8:97394437-97394459 CCAACTCCAGCAATTCTTTGGGG - Intergenic
1045820902 8:106336638-106336660 CTAAATCTTTTATTACTTTGGGG + Intronic
1046223240 8:111242367-111242389 ATAAATCATTCATTTCTTTCAGG + Intergenic
1046519676 8:115308391-115308413 CTAAGTACTTCATTTTTTTGTGG + Intergenic
1046540283 8:115572112-115572134 TTAAAGCATGCATGTCTTTGTGG + Intronic
1048687353 8:136919193-136919215 CAAAATCCTGCATTACTTTTGGG - Intergenic
1050478142 9:6062313-6062335 CATAGTCCTGCATTTCTTGGAGG + Intergenic
1051066906 9:13115588-13115610 CTCAATTCTCCATTTCTTTTTGG - Intronic
1052537477 9:29765559-29765581 CAAAATCCTGCATCTCTTTATGG + Intergenic
1052626238 9:30980773-30980795 CCAGATCCTGCATCTCTCTGGGG + Intergenic
1053630947 9:39936929-39936951 CTCATTTCTGCCTTTCTTTGAGG - Intergenic
1053774821 9:41526576-41526598 CTCATTTCTGCCTTTCTTTGAGG + Intergenic
1054212940 9:62313769-62313791 CTCATTTCTGCCTTTCTTTGAGG + Intergenic
1055553595 9:77453680-77453702 CTAAATGCTGCATTTGTTGAAGG - Intronic
1055658788 9:78479938-78479960 CTAAACCCTCAATATCTTTGAGG - Intergenic
1055840215 9:80494319-80494341 CCAAATCCTGCATTTCTGTTTGG + Intergenic
1056244958 9:84685725-84685747 CTAACTCCTGCTTATCTTTTAGG + Intronic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057583854 9:96312190-96312212 CAAAATCAAGCATTTATTTGGGG - Intergenic
1058143140 9:101379701-101379723 CTAAATCCTAAATTATTTTGTGG + Intronic
1059211811 9:112519685-112519707 CCAAATCCTTCAGTTCTTTGAGG + Intronic
1060513961 9:124254339-124254361 CTGAATCCTGAAACTCTTTGGGG + Intergenic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1062563901 9:137155441-137155463 CGAAGGGCTGCATTTCTTTGTGG + Intronic
1203699250 Un_GL000214v1:122470-122492 CCACATCCTGCGTTTTTTTGGGG - Intergenic
1203568960 Un_KI270744v1:114450-114472 CTACGTCCTGCATCTTTTTGGGG - Intergenic
1203569546 Un_KI270744v1:118718-118740 CCACATTCTGCGTTTCTTTGGGG - Intergenic
1185545012 X:936366-936388 CTAGATTCTGCATTTCTTCTGGG + Intergenic
1186221223 X:7351374-7351396 CAAAATCATGCATCTCATTGTGG - Exonic
1187276900 X:17824234-17824256 CTAGGGCCTGCATTTCCTTGAGG - Intronic
1189852539 X:45191823-45191845 CTCAATGCTGCAGGTCTTTGGGG + Exonic
1192869334 X:75171573-75171595 GTAAATCCGGGATTTCTTTTTGG + Intergenic
1193052153 X:77112843-77112865 CATAATCCTGTATTTCTTGGAGG - Intergenic
1193129549 X:77905236-77905258 CTGATTCCTCCATTCCTTTGGGG - Exonic
1193277472 X:79606001-79606023 CAGAATCCTGTATTTCTCTGAGG - Intergenic
1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG + Intronic
1194595152 X:95848177-95848199 CTGAATCCTGCATGTCTCAGAGG - Intergenic
1195920492 X:109978499-109978521 CTAAATCAGGTATTGCTTTGCGG + Intergenic
1196463023 X:115948796-115948818 CTTAACCCAGCCTTTCTTTGAGG - Intergenic
1199216685 X:145267070-145267092 CGTAATCCTGTATTTCTTCGAGG - Intergenic