ID: 1018885920

View in Genome Browser
Species Human (GRCh38)
Location 6:167937106-167937128
Sequence GAGTGTGTACAGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018885917_1018885920 -3 Left 1018885917 6:167937086-167937108 CCAGTGGGTCTGCAGGAAAGGAG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018885920 Original CRISPR GAGTGTGTACAGAAGGTGCA GGG Intronic
No off target data available for this crispr