ID: 1018886158

View in Genome Browser
Species Human (GRCh38)
Location 6:167939850-167939872
Sequence ACATTGTCACAGATAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018886155_1018886158 -3 Left 1018886155 6:167939830-167939852 CCTAGATTCAAGGAAACCCAACA 0: 1
1: 0
2: 2
3: 16
4: 216
Right 1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 177
1018886152_1018886158 16 Left 1018886152 6:167939811-167939833 CCGTAGTGTGTCTTAGGTCCCTA 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 177
1018886154_1018886158 -2 Left 1018886154 6:167939829-167939851 CCCTAGATTCAAGGAAACCCAAC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018886158 Original CRISPR ACATTGTCACAGATAGAGTG AGG Intronic
900041127 1:465363-465385 ACATTGGTACTGGTAGAGTGGGG - Intergenic
900062558 1:700339-700361 ACATTGGTACTGGTAGAGTGGGG - Intergenic
904251485 1:29227759-29227781 ACACTGTCACAGAAAGAATCAGG - Intronic
909043153 1:70677835-70677857 ACTTGGTCACAGGTAGCGTGGGG - Intergenic
911093793 1:94039455-94039477 ACATTCTCTCACATAGAGAGGGG + Intronic
911113212 1:94213705-94213727 ACATTGTAAGAGAGAGAGTTAGG - Intronic
911301442 1:96179479-96179501 ACACTTTCAAGGATAGAGTGGGG - Intergenic
911629480 1:100166243-100166265 AAATTGGTACCGATAGAGTGGGG + Intronic
914454505 1:147823362-147823384 ACACTGCCTTAGATAGAGTGGGG + Intergenic
918639013 1:186815662-186815684 ACTCTGTCACAGATAAATTGGGG + Intergenic
920002488 1:202809236-202809258 ACATAGTGACAGATTGAGGGGGG + Exonic
921633218 1:217459653-217459675 TCATTATCAAAGAGAGAGTGTGG - Intronic
1064656585 10:17561993-17562015 AAATTTTCATAGGTAGAGTGGGG - Intergenic
1064965009 10:21006455-21006477 GCATTGTCACAGAAAGATTATGG - Intronic
1065565387 10:27002484-27002506 ACATGGTCCCAGTTAGAGTGAGG + Intronic
1066293095 10:34031487-34031509 ACATTTTCATAGATAGAGGATGG - Intergenic
1068243449 10:54335776-54335798 AAATTGGCACTGGTAGAGTGGGG + Intronic
1068352979 10:55873298-55873320 ACATTGGCACAGATAGACACTGG - Intergenic
1069434117 10:68365437-68365459 ACATTGTCCCAGCCTGAGTGTGG + Intronic
1069640019 10:69948808-69948830 CCCTTGTCACAGACAGAGGGAGG + Intronic
1070580789 10:77717610-77717632 ACTTTGTCACAGAGAGGCTGAGG + Intergenic
1073893937 10:108132295-108132317 ACATGGACACACATGGAGTGAGG + Intergenic
1076623676 10:131808847-131808869 ACAGAGGCACAGATAGAGGGAGG - Intergenic
1076967398 11:101593-101615 ACATTGGTACTGGTAGAGTGGGG - Intergenic
1077277707 11:1723069-1723091 AAATTGTCCCAGATAGAATGCGG + Intergenic
1079948282 11:26770073-26770095 ACAATGTCAAAGAGAGATTGAGG - Intergenic
1080723468 11:34871811-34871833 ACATGGACACACAAAGAGTGAGG - Intronic
1081167217 11:39821105-39821127 AAATTGGTACTGATAGAGTGGGG - Intergenic
1082201354 11:49373559-49373581 AGCTTGTCACAGATAAAGAGTGG + Intergenic
1082701591 11:56438613-56438635 ACATGGTCTCAGACTGAGTGTGG - Intergenic
1085249957 11:75136489-75136511 AAATTGGTACCGATAGAGTGCGG + Intronic
1085956579 11:81405050-81405072 ACAATGACACAGAAAGATTGAGG - Intergenic
1086235759 11:84628005-84628027 CCATTGTCACTGATAGAGTTTGG - Intronic
1086654318 11:89332678-89332700 AGCTTGTCACAGATAAAGAGTGG - Intronic
1087501580 11:98961612-98961634 TCAATGTTACAAATAGAGTGGGG + Intergenic
1087807391 11:102569645-102569667 AAATTGTTACTGGTAGAGTGGGG - Intergenic
1087942942 11:104122594-104122616 ACATGGACACATAAAGAGTGAGG - Intronic
1088510700 11:110571025-110571047 ACATTGTCCCAGGATGAGTGTGG - Intergenic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1089913748 11:122130677-122130699 ACACTGTCACAGATTGAGACTGG + Intergenic
1093278036 12:17153533-17153555 ACATTGGTACTGGTAGAGTGGGG - Intergenic
1093594641 12:20946014-20946036 ACATGGACACACAAAGAGTGAGG + Intergenic
1097357122 12:58614348-58614370 ACTTGATCACAGATAAAGTGTGG - Intronic
1098499076 12:71169430-71169452 AGAATGTCTCAGAGAGAGTGAGG + Intronic
1099566362 12:84252918-84252940 TCATAGTGACAGATAGAGGGAGG - Intergenic
1104099187 12:125590070-125590092 ACATGGTCAGAGAGGGAGTGAGG - Intronic
1109468993 13:62779686-62779708 ACATGGACACACAAAGAGTGAGG - Intergenic
1113052080 13:106223994-106224016 ACATTTTCACAAATAGAGAGTGG + Intergenic
1117846822 14:59920253-59920275 ACCTTATCACAGAGAGAGGGTGG - Intronic
1117990036 14:61424226-61424248 AAATTGGTACTGATAGAGTGGGG + Intronic
1120021025 14:79530261-79530283 ACATAGTCACATTTAAAGTGAGG + Intronic
1123872286 15:24589042-24589064 AAATTGTTACTGAGAGAGTGGGG + Intergenic
1124028265 15:25986931-25986953 ATATTGTATCAGTTAGAGTGGGG - Intergenic
1124230241 15:27938750-27938772 ACATTGTCAGAGAAAGACAGTGG + Intronic
1124443597 15:29708262-29708284 CCAGGGTCACAGCTAGAGTGAGG - Intronic
1130382301 15:83380784-83380806 ACAGTGTCACAGTCACAGTGGGG + Intergenic
1131453258 15:92563562-92563584 CCAGCGTCTCAGATAGAGTGTGG - Intergenic
1132440773 15:101862234-101862256 ACATTGGTACTGGTAGAGTGGGG + Intergenic
1133534635 16:6689565-6689587 ACATTGTCATAGACAGGCTGAGG - Intronic
1135038627 16:19099661-19099683 ACATAGTCACAGGTTGTGTGTGG + Intergenic
1135043196 16:19133696-19133718 ATAATTTCACAGATAGAGTTTGG - Intronic
1144850399 17:18241236-18241258 ATTTTGTCACAGATCGAGAGAGG + Intronic
1147217052 17:38906875-38906897 TCATGGGCACAGGTAGAGTGTGG + Intronic
1151160142 17:72158378-72158400 ACAATTTCACAGATAGGGGGAGG + Intergenic
1155817828 18:30336780-30336802 AAATTGACACAGAGATAGTGTGG + Intergenic
1156515171 18:37673316-37673338 CCATTGTCAGAGAAAGAGTTTGG - Intergenic
1157878453 18:51295446-51295468 ACATAGTAACAGGTAGAGTTTGG - Intergenic
1158009694 18:52714772-52714794 AAATTGTCAGAGAGAGAGAGAGG - Intronic
1158879259 18:61760890-61760912 ACATTCTCACTGATAGTGTTTGG - Intergenic
1160644202 19:171216-171238 ACATTGGTACTGGTAGAGTGGGG - Intergenic
1161831050 19:6604775-6604797 ACATAGACATAGAAAGAGTGAGG + Intergenic
925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG + Intergenic
926376131 2:12229413-12229435 TCATTCTCACAGATAGACTCAGG - Intergenic
931987177 2:67753507-67753529 ACATTGTAACAGGGGGAGTGGGG + Intergenic
932727507 2:74192150-74192172 ACATGGACACACAAAGAGTGAGG - Intergenic
935115688 2:100134065-100134087 ACATTTCCAAAGATAGAGAGTGG - Intronic
935139786 2:100342840-100342862 AAATTGGTACAGGTAGAGTGGGG + Intergenic
935385326 2:102493277-102493299 AAATTGGTACAGGTAGAGTGGGG - Intronic
935422543 2:102884940-102884962 ACATTGTCACTGGTTGAATGAGG - Intergenic
940043183 2:149381459-149381481 AGATTCTCACAGGTAGAGAGAGG + Intronic
940979349 2:159984099-159984121 ACATTGTTATAGATAAAGTCAGG + Intronic
942471476 2:176265250-176265272 ACATTGTTACAGATATGGTTTGG + Intergenic
942904853 2:181167861-181167883 AAATTGTTACTGGTAGAGTGAGG - Intergenic
943246080 2:185452192-185452214 ACATTGGTAGAGGTAGAGTGTGG - Intergenic
943299794 2:186183824-186183846 AAATTGGCACTGGTAGAGTGGGG + Intergenic
943521537 2:188957411-188957433 AGAGTGATACAGATAGAGTGGGG - Intergenic
946459534 2:219856814-219856836 ACATGTTCAGAGAAAGAGTGGGG + Intergenic
946844783 2:223849685-223849707 AAATTGGTACTGATAGAGTGGGG + Intergenic
948135568 2:235633614-235633636 GAATTGTCATAGATGGAGTGGGG + Intronic
948325548 2:237117354-237117376 AGATGGTCTCAGATAGTGTGAGG + Intergenic
1169748751 20:8969873-8969895 ATATTGTCACTGAAAGTGTGGGG + Intergenic
1174048711 20:47752345-47752367 ACATGGTCAATGGTAGAGTGAGG + Intronic
1177796494 21:25784181-25784203 ACATCCTCACAGATGAAGTGAGG - Intergenic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1184360701 22:44016433-44016455 ACATGGACACACAGAGAGTGAGG - Intronic
949361373 3:3235590-3235612 ACATTGTCAGAGCTAGATTATGG + Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
955057923 3:55472636-55472658 TAATTGCCACAGACAGAGTGTGG - Intronic
956375523 3:68609595-68609617 AAATTGTTACTGGTAGAGTGGGG - Intergenic
957267302 3:77983685-77983707 AAATTGGCACTGGTAGAGTGGGG - Intergenic
960544422 3:118896450-118896472 ACATTGATACAAATAGACTGGGG + Intergenic
961789449 3:129365294-129365316 AAATTGGCACCAATAGAGTGGGG - Intergenic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
963364799 3:144321253-144321275 ACATGGACACACAAAGAGTGAGG - Intergenic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
964863255 3:161225053-161225075 ACAATGTCAAAGGTACAGTGCGG + Exonic
967515348 3:190362159-190362181 ACATGGACACACAAAGAGTGAGG - Intronic
971145704 4:23974234-23974256 ACATTGTCACAGATGGTTTGCGG - Intergenic
971766693 4:30841663-30841685 ACATTTTCACATATACAGGGGGG - Intronic
972036603 4:34530441-34530463 ACATTGTCAAAGATAGACTGTGG - Intergenic
975566847 4:75765905-75765927 ACATAATCACAGATATACTGAGG - Intronic
976880042 4:89910259-89910281 AAATTGTCACAAAGAGAGTGAGG - Intronic
977997124 4:103508066-103508088 TTCTTGTCACAGATTGAGTGGGG - Intergenic
978292556 4:107161036-107161058 ATAATGTCAGAGATAGAGAGGGG + Intronic
978416317 4:108480658-108480680 ATATTATAACAGATAGAGTCAGG + Intergenic
979481273 4:121220669-121220691 AAATTGTCATAAATAGCGTGGGG + Intronic
979738668 4:124121776-124121798 ACATTGTCACAGAGAATGTTTGG + Intergenic
983989477 4:174100360-174100382 AGACTGGCAGAGATAGAGTGTGG + Intergenic
986908137 5:12520103-12520125 ATATTGGTACAGGTAGAGTGGGG - Intergenic
987441532 5:17962722-17962744 GCATTGTCACAGATAGCTGGTGG + Intergenic
990135270 5:52637266-52637288 ACATTGTCTCTGTTAGTGTGTGG + Intergenic
990858175 5:60295609-60295631 ACATTGTCACAGCTAGAGGAAGG - Intronic
991940269 5:71844555-71844577 AAATTTTCACTGATAGAGGGAGG - Intergenic
992215734 5:74523219-74523241 AAATTGACACCAATAGAGTGGGG + Intergenic
993443701 5:87986702-87986724 AAATTGTTTCAGAAAGAGTGAGG - Intergenic
993475116 5:88355120-88355142 ACATTGTAAAAGATGGATTGTGG + Intergenic
995011496 5:107261149-107261171 AAATTGGTACAAATAGAGTGGGG - Intergenic
995283732 5:110363333-110363355 ACAATCTCACTGATAGAGTTTGG - Intronic
995585308 5:113642535-113642557 AAGATGTCACAGATAGTGTGGGG + Intergenic
995665928 5:114542448-114542470 ACATCATCAAATATAGAGTGAGG + Intergenic
996284559 5:121773514-121773536 ACAGTGTAACAGATAAAGTATGG - Intergenic
998487798 5:142517976-142517998 ACTTTGTCTCAGATAGACTTTGG + Intergenic
998998135 5:147889290-147889312 ACATATTCACATGTAGAGTGGGG - Intronic
1002732719 5:181353565-181353587 ACATTGGTACTGGTAGAGTGGGG + Intergenic
1002751819 6:120541-120563 ACATTGGTACTGGTAGAGTGGGG - Intergenic
1005461910 6:26077419-26077441 AGATGGTCAGAAATAGAGTGAGG - Intergenic
1005631362 6:27711219-27711241 GCATTGTCACAGGTAAAGAGAGG + Intergenic
1006275380 6:33001258-33001280 ACATTGTGCCAGAGAGAGAGAGG + Intergenic
1010900447 6:81421950-81421972 AAATAGTTACCGATAGAGTGGGG + Intergenic
1011018157 6:82781813-82781835 ACAGTTTCACAGATAGCCTGGGG + Intergenic
1011343877 6:86347596-86347618 ACATTGGTACGGGTAGAGTGGGG - Intergenic
1012384880 6:98668743-98668765 CCATTGCCACAGATAGTGTGTGG - Intergenic
1012657143 6:101838500-101838522 ACACTGTCACAGTAAGACTGTGG + Intronic
1012738384 6:102980472-102980494 ACATTTTCACTTATTGAGTGAGG + Intergenic
1013003085 6:106044041-106044063 ACATATTCACACATATAGTGGGG - Intergenic
1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG + Intronic
1013730132 6:113155390-113155412 AGAATGTCCCAGATAGACTGGGG + Intergenic
1015110825 6:129589685-129589707 ATATTGGTACCGATAGAGTGGGG - Intronic
1015185383 6:130409540-130409562 ATTCTGTCACAGATAGAATGTGG - Intronic
1017547658 6:155469135-155469157 ACATTGGTACCAATAGAGTGGGG - Intergenic
1017556306 6:155574488-155574510 ACATAGCCAAAGATATAGTGAGG - Intergenic
1018652073 6:166000636-166000658 GCATTGTCACAGATAGCATGGGG - Intergenic
1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG + Intronic
1019236974 6:170625883-170625905 ACATTGGTACTGGTAGAGTGGGG + Intergenic
1030480330 7:110095504-110095526 ACATTCTCATAGAAATAGTGTGG - Intergenic
1031145616 7:117994282-117994304 AAATTGTTACTGGTAGAGTGGGG + Intergenic
1034294865 7:149963245-149963267 ACTCTGTCCCAGATACAGTGGGG + Intergenic
1034602717 7:152277575-152277597 ACATTGTTACAGATCAAGAGTGG - Intronic
1034811199 7:154133707-154133729 ACTCTGTCCCAGATACAGTGGGG - Intronic
1035510796 8:180727-180749 ACATTGGTACTGGTAGAGTGGGG - Intergenic
1037914116 8:22761626-22761648 ACATTGTTTCAGATTGAATGAGG + Intronic
1040293113 8:46135585-46135607 ACATTGACGCAGACAGAGGGAGG - Intergenic
1041182207 8:55260503-55260525 ACATGGACACACATGGAGTGAGG + Intronic
1041212013 8:55561406-55561428 AATTTATCAGAGATAGAGTGAGG - Intergenic
1041305648 8:56455609-56455631 ACATTGTCCCAGTCTGAGTGAGG - Intergenic
1041422708 8:57686601-57686623 ACTTTGTCACTGATATGGTGTGG - Intergenic
1043206785 8:77454230-77454252 TCCTTTTCACAGATAGAGAGAGG + Intergenic
1044411379 8:91887600-91887622 AAAATTTCACAGATAGTGTGAGG - Intergenic
1045223346 8:100220379-100220401 ACAGTGTTGCAGATAGACTGTGG + Exonic
1046232210 8:111372905-111372927 AAATTGTTACAGGTGGAGTGAGG + Intergenic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1048668448 8:136690391-136690413 AAATTGGCACTGGTAGAGTGGGG - Intergenic
1048745682 8:137612360-137612382 CCAGTGTCACAGATAGAGAAGGG + Intergenic
1052394158 9:27917401-27917423 ACAGAGACACAGAGAGAGTGAGG - Intergenic
1055025238 9:71712496-71712518 ACATTATCATAGATTGGGTGGGG + Intronic
1056026753 9:82505410-82505432 CCATTGTCACAGAGCTAGTGTGG - Intergenic
1056502087 9:87219558-87219580 AAACTGTCACAGATGCAGTGCGG + Intergenic
1062757126 9:138305889-138305911 ACATTGGTACTGGTAGAGTGGGG + Intergenic
1186728092 X:12378287-12378309 ACTTTGTCACAGCAAGAGTAAGG + Intronic
1187020542 X:15376721-15376743 ACATTGTCACAGCAAGACTAGGG - Intronic
1188169808 X:26910946-26910968 AAATTGGTACCGATAGAGTGGGG + Intergenic
1188557421 X:31428315-31428337 ACATGGTGAGAGATGGAGTGAGG - Intronic
1193013594 X:76706545-76706567 ACATTCTCACTGATACAGTTTGG - Intergenic
1194210084 X:91060900-91060922 ACATTGTCAGTAATATAGTGGGG - Intergenic
1195686986 X:107596441-107596463 ATATTCTCACAGATAAAATGGGG + Intronic
1195816662 X:108895934-108895956 AAATTGGTACACATAGAGTGGGG + Intergenic
1197074852 X:122341874-122341896 ACATTGGTACTGGTAGAGTGAGG - Intergenic
1197426536 X:126304242-126304264 AAATTGGCACTGGTAGAGTGCGG + Intergenic
1199565980 X:149216313-149216335 AAATTGTTACCGGTAGAGTGGGG + Intergenic
1199716923 X:150513193-150513215 ATTTTGTCACAGGTAGAGAGAGG - Intronic