ID: 1018886840

View in Genome Browser
Species Human (GRCh38)
Location 6:167946052-167946074
Sequence AAGCAAACACACACCACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018886839_1018886840 12 Left 1018886839 6:167946017-167946039 CCAAGGCATCAGAGAACGTGACT 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1018886840 6:167946052-167946074 AAGCAAACACACACCACCCAAGG 0: 1
1: 0
2: 4
3: 24
4: 279
1018886838_1018886840 18 Left 1018886838 6:167946011-167946033 CCACAGCCAAGGCATCAGAGAAC 0: 1
1: 0
2: 9
3: 32
4: 329
Right 1018886840 6:167946052-167946074 AAGCAAACACACACCACCCAAGG 0: 1
1: 0
2: 4
3: 24
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018886840 Original CRISPR AAGCAAACACACACCACCCA AGG Intronic
900588849 1:3449943-3449965 ATATACACACACACCACCCAAGG - Intergenic
901516586 1:9751335-9751357 AAGCAAACACACACCAGGTTAGG + Intronic
903745535 1:25584298-25584320 AAGAAGACACCCACCACACAAGG - Intergenic
905209837 1:36366504-36366526 GAGCAAAGACACAGCTCCCAGGG + Intronic
905226291 1:36481280-36481302 AGGCCAACACCCAGCACCCAGGG - Intronic
912012996 1:104994834-104994856 AATCAAACAGAAAACACCCAAGG + Intergenic
913976490 1:143461419-143461441 AGTCAAACACACACCATCCTGGG + Intergenic
914070891 1:144287035-144287057 AGTCAAACACACACCATCCTGGG + Intergenic
914108264 1:144679320-144679342 AGTCAAACACACACCATCCTGGG - Intergenic
915168529 1:153962380-153962402 AAGCAAACAAACCCCCTCCAGGG + Intronic
920179721 1:204124958-204124980 ACGCATACACACAGCACCCCTGG - Intronic
921220948 1:212973648-212973670 AAGCAAACAAACACAGCCCCGGG + Intronic
922981685 1:229832205-229832227 GACCACACAAACACCACCCAAGG - Intergenic
923670450 1:236036204-236036226 AAGCAAAGACACACCACCCCTGG + Intronic
924609579 1:245562658-245562680 AAGGTAACTCACACTACCCAAGG - Intronic
1062934686 10:1376996-1377018 ACACAAACACACACACCCCAGGG - Intronic
1062934709 10:1377130-1377152 ACACAAACACACACACCCCAGGG - Intronic
1062934733 10:1377243-1377265 ACACAAACACACACACCCCAGGG - Intronic
1063499818 10:6543395-6543417 AAGCAAAAACACAACACCATGGG + Intronic
1064173101 10:13051293-13051315 AAGCTAACACCCACGACCCTAGG + Intronic
1064602553 10:17008230-17008252 ACACACACACACACCACACACGG - Intronic
1065371539 10:24991807-24991829 GAGCAAACACAAGCCACCTATGG + Intronic
1066037557 10:31508652-31508674 ATGCCTACACACACCACCAAGGG - Intronic
1067580799 10:47444235-47444257 AAGCCAAAACACAGCATCCAGGG - Intergenic
1069144551 10:64873924-64873946 AAACAAACAAAAAACACCCAAGG + Intergenic
1070415057 10:76181479-76181501 AAGCCAACAAATACCACCCACGG - Intronic
1072642652 10:97223940-97223962 AAACACACATAAACCACCCAAGG + Exonic
1072761656 10:98061802-98061824 GCGCACACACACACCAGCCAAGG - Intergenic
1073220175 10:101865370-101865392 ATGCACACAAACACCACACATGG + Intronic
1073511893 10:104047688-104047710 AAGCACACACACACTAAGCAGGG + Intronic
1073556193 10:104454422-104454444 AAACAAGGACACAGCACCCATGG + Exonic
1073756120 10:106582453-106582475 CAGCAAGCAGACACCACCCACGG - Intronic
1074010224 10:109471074-109471096 ACACACACACACACCACACACGG + Intergenic
1075808932 10:125210272-125210294 AAACAAACAAACACTTCCCAGGG - Intergenic
1075935185 10:126334510-126334532 AAGCAGGCACACACTTCCCATGG - Intronic
1076681987 10:132177513-132177535 ACACACACACACACTACCCAGGG - Intronic
1078464524 11:11540376-11540398 AAACAAACCCAAACCACCCAGGG - Intronic
1080452847 11:32392989-32393011 AAGAAACCACACCTCACCCAGGG - Intronic
1085264002 11:75225613-75225635 AAACAAACAAACACCAGACAGGG - Intergenic
1085599241 11:77840108-77840130 ACACACACACACAACACCCAGGG + Intronic
1088780342 11:113128078-113128100 AATAAAACAGACACCAGCCAAGG - Intronic
1091090550 11:132767272-132767294 GTGCACACACACACCACCCAGGG - Intronic
1091540227 12:1453927-1453949 AAACAAACACGCATCACTCAGGG - Intronic
1093604327 12:21072082-21072104 ACACACACACACACAACCCAAGG - Intronic
1094089476 12:26632080-26632102 AAGTCAACACACACAACCCCTGG + Intronic
1094579716 12:31723224-31723246 ACGCACACACACACCACCCCTGG + Intronic
1095225297 12:39671702-39671724 CCACACACACACACCACCCAGGG - Intronic
1095726130 12:45455168-45455190 AAGCAAATACACATCCTCCATGG - Intergenic
1096069366 12:48766437-48766459 AAGCAGAGACAAGCCACCCAAGG + Exonic
1097319681 12:58211352-58211374 AAGCAAACACATCCCTCTCATGG + Intergenic
1098304701 12:69090856-69090878 AAACAAAAACACAGCACCCCAGG - Intergenic
1099666386 12:85635005-85635027 AAGCAAACAAACACACCCAAGGG - Intergenic
1100347962 12:93751260-93751282 AGGTAAACAAACACCATCCAGGG - Intronic
1101890919 12:108714452-108714474 AAACACACACACACACCCCAAGG + Intronic
1101902492 12:108801013-108801035 AAGGAAACACACATTAACCAAGG + Intronic
1102459487 12:113091471-113091493 ACACAAACACACACAACCCAGGG - Intronic
1103295802 12:119885752-119885774 TAGCACACACACCCCAGCCATGG + Intergenic
1105222745 13:18348402-18348424 AATCAAACACACATCATCCTGGG - Intergenic
1106245022 13:27941737-27941759 AAGAAAACAGAAACCACTCAAGG + Intergenic
1108662127 13:52596902-52596924 GAGCATACACACACGACCCTAGG + Intergenic
1110978040 13:81864961-81864983 AAGCAAAAACAAAGCAACCAAGG + Intergenic
1111376128 13:87380782-87380804 GATCAAACCCACACCACCCAAGG - Intergenic
1113119585 13:106912086-106912108 AAGAAACCACACACAAACCAAGG - Intergenic
1115128295 14:30023040-30023062 ACTCAGACACACACCACACAGGG - Intronic
1117340013 14:54784612-54784634 AAGAACACACTCACCTCCCAGGG - Exonic
1119892765 14:78195272-78195294 AAACAAACAAACACCCTCCAGGG - Intergenic
1122224132 14:100263430-100263452 AAACAAACACACCCAACCAATGG - Intronic
1122519856 14:102335561-102335583 AAGGAAACGCACACCACTGAGGG + Intronic
1202895921 14_GL000194v1_random:10117-10139 AAGCAAGCCCACACCAGACATGG + Intergenic
1124421597 15:29527736-29527758 AAACACACACACAACACACAAGG + Intronic
1124602752 15:31148799-31148821 CAGCACACAGACACCACCCCAGG + Intronic
1125220530 15:37327972-37327994 AAGCAACCTGACAACACCCATGG + Intergenic
1125322853 15:38507314-38507336 AAACAAACAAAAAACACCCAGGG - Intronic
1125857513 15:42964487-42964509 AAACAAACAAACAAAACCCATGG + Intronic
1125865411 15:43043201-43043223 AAACAAACACTCACCAGCAAGGG + Exonic
1126427696 15:48547124-48547146 AAGCAAAAACACACAAGTCAGGG - Intronic
1126920066 15:53511326-53511348 AAGCAAACACACACAATTCCAGG - Intergenic
1128341283 15:66824144-66824166 ATGCAAAAACACACTTCCCAGGG + Intergenic
1130959368 15:88649557-88649579 AAGAAAAGACACATGACCCATGG + Intronic
1133484783 16:6209321-6209343 GAAGAAACACACACAACCCAGGG - Intronic
1133893793 16:9906309-9906331 GAGCAAACCCAAACCACTCATGG + Intronic
1134072034 16:11266245-11266267 AAGAAAACACACACCAGGCTTGG + Intronic
1136420613 16:30130218-30130240 AGGCACACATACACCACCCCTGG + Intergenic
1138054088 16:53814179-53814201 AAGCAAAACCAAACCACCAAGGG + Intronic
1139277978 16:65745634-65745656 AAGAAAACATGCACAACCCAAGG + Intergenic
1140793859 16:78417032-78417054 AAACACACACACACCCCCAAAGG - Intronic
1141118688 16:81333898-81333920 CAGCACACACACAGCACCCCAGG - Intronic
1141298979 16:82795608-82795630 AAGCTTACACACCTCACCCAAGG + Intronic
1142584130 17:960139-960161 AATCAGAAACCCACCACCCACGG + Intronic
1142795920 17:2306729-2306751 AAACAAACACTTTCCACCCATGG + Intronic
1144523768 17:15972302-15972324 AAGCAAACAAACACTTCCCATGG + Intronic
1146252606 17:31362496-31362518 AATCAAACAGACAACAGCCATGG - Intronic
1146919801 17:36703012-36703034 AAGCTCCCACACATCACCCAGGG - Intergenic
1147490178 17:40858797-40858819 AAACAAACAAACAAAACCCATGG + Intergenic
1148897082 17:50845225-50845247 CAGCACACACATACCACTCAGGG + Intergenic
1149342307 17:55699459-55699481 AAGCCAACTCCCACCACCCTAGG + Intergenic
1149667644 17:58376989-58377011 AATACAACACACACCACCGAAGG - Intronic
1150105036 17:62456372-62456394 GAGCAACCACACACCTCCCAGGG - Intergenic
1152480133 17:80545372-80545394 CCGCAGACACACACCACCCCAGG - Exonic
1153067406 18:1062193-1062215 AGACAAACATACACCACCAAAGG - Intergenic
1153189278 18:2519916-2519938 ATGCCACCACACACCACACATGG - Intergenic
1153361927 18:4207240-4207262 AAGCAAACACATCCCTCACATGG + Intronic
1154333052 18:13445432-13445454 CTGCATACACACTCCACCCATGG - Intronic
1155128049 18:22900417-22900439 AAGCAAAGACAGACCATCTAAGG + Intronic
1158800704 18:60905273-60905295 AAGCAAACAAAACCCACCAATGG - Intergenic
1161044303 19:2126918-2126940 AAGCAAACACCCAGCACCAATGG + Intronic
1161657302 19:5524162-5524184 AAGCAGACAGACACAAACCAAGG - Intergenic
1162311656 19:9911502-9911524 CAGAAAACACACAGCACACAGGG + Intronic
1164506455 19:28865292-28865314 AAGCAAACAAACATCACAGAGGG + Intergenic
1164588342 19:29491720-29491742 CAGCCAACACACAGCAGCCAGGG + Intergenic
1164928937 19:32157689-32157711 AAGCAAACAAACGCCTCCCCAGG - Intergenic
1165151288 19:33761960-33761982 AACCACACACTCCCCACCCAGGG + Intronic
1166198978 19:41223961-41223983 ACACACACACACACCACACATGG - Intronic
1166691411 19:44823307-44823329 TTGCACTCACACACCACCCAGGG + Intergenic
1166757709 19:45203692-45203714 CAGAAATCAGACACCACCCATGG - Intronic
1167357478 19:49012871-49012893 ACACACACACACACCACCCCTGG + Intronic
1167815936 19:51881110-51881132 AAGTAAACAAAAACCACCTATGG + Intronic
1168099313 19:54132827-54132849 AAACAAACAAACAAAACCCATGG - Intergenic
926146267 2:10398705-10398727 AGGAAAACCCACCCCACCCACGG - Intronic
926216696 2:10910007-10910029 ACACATACACACACCACCCTAGG - Intergenic
928081841 2:28318943-28318965 AGGCAAACACAGACAGCCCAGGG - Intronic
928316660 2:30251792-30251814 AAGCAGCCACTCACCACACAGGG - Intronic
928915669 2:36467687-36467709 AATCAAACAGAAAGCACCCACGG + Intronic
930351790 2:50265781-50265803 AAGCAAATACATTTCACCCAGGG + Intronic
930446197 2:51475366-51475388 AAATAACCACAAACCACCCAAGG + Intergenic
930901403 2:56511448-56511470 AAGTAAACACACACCAACCTGGG - Intergenic
934181194 2:89622385-89622407 AGTCAAACACACACCATCCTGGG + Intergenic
934291491 2:91696624-91696646 AGTCAAACACACACCATCCTGGG + Intergenic
934677051 2:96257033-96257055 AAGAAAAGACACAGCACTCAAGG + Intronic
934897768 2:98133325-98133347 CAGCAAACACACACTTCCCCAGG - Intronic
936175878 2:110219360-110219382 CAGCAAACCCACACCCCACAAGG + Intergenic
936849030 2:116873735-116873757 AAGCACACCCACTCCACCAAGGG - Intergenic
936872599 2:117150335-117150357 AAGCAAACACAAACAACTAATGG - Intergenic
936913874 2:117619530-117619552 AAGAAATCACTCACCATCCAGGG + Intergenic
938202311 2:129383704-129383726 AAGCACACACACCCAACCCCTGG - Intergenic
938310683 2:130286558-130286580 AGGCAAACAGACTCCCCCCAGGG + Intergenic
938500118 2:131827951-131827973 CAGGAAACCCACACCAGCCATGG + Intergenic
939533018 2:143389378-143389400 AAGCAACCTTACACCACGCAAGG + Intronic
940278176 2:151961516-151961538 AAGCCAACACACATCTCCAAAGG + Intronic
944199097 2:197086258-197086280 AAGTGCACACACACCACCAATGG - Intronic
944280835 2:197894660-197894682 AGGCAAACACACACAATCCAAGG - Intronic
947569676 2:231222832-231222854 AAGCAAATAGAGACCACCTATGG + Intronic
948000009 2:234560033-234560055 AAGCAATCACAAACCATTCAGGG + Intergenic
948131929 2:235607440-235607462 AAGCAAACTCACAGAGCCCAGGG + Intronic
948775385 2:240285562-240285584 AAACAAACAAACAGAACCCATGG + Intergenic
1168933472 20:1644092-1644114 AAGCACACTCACTCCACCAAGGG - Intronic
1168949871 20:1789986-1790008 CAGCAAACAAATTCCACCCAGGG - Intergenic
1170365424 20:15593043-15593065 AAGCACACACAAACCAACCCGGG + Intronic
1171114069 20:22509282-22509304 AGGCAAAGAGACACAACCCAAGG - Intergenic
1172487000 20:35304339-35304361 AGACAGACACACACCTCCCAAGG + Intronic
1173190250 20:40870495-40870517 ATACACACACACACCACACATGG - Intergenic
1173274392 20:41566753-41566775 GAGACACCACACACCACCCAGGG - Intronic
1173317944 20:41961706-41961728 AAGCAAACACACACCTTACATGG - Intergenic
1176084939 20:63291552-63291574 GAGCCACCACACCCCACCCATGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176426515 21:6552062-6552084 ACACACACACACACCACACACGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176615607 21:9026169-9026191 AAGCAAGCCCACACCAGACATGG + Intergenic
1176709565 21:10137635-10137657 AAGCAAGCCCACACCAGACATGG - Intergenic
1176731294 21:10500825-10500847 AATCAAACACACATCATCCTGGG - Intergenic
1177574763 21:22938257-22938279 AAAAAAACAAACACCACCAAGGG + Intergenic
1178807443 21:35851271-35851293 AAGAAAATACACAGCTCCCAAGG + Intronic
1179827312 21:43973435-43973457 AAGCCACCACTAACCACCCAAGG - Intronic
1180634942 22:17256830-17256852 GAGCCAACACACCCCACCTAAGG + Intergenic
1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG + Intergenic
1184714265 22:46271872-46271894 AATGAAATACACATCACCCAAGG - Intronic
1184722173 22:46321199-46321221 AAGAAAACAAACACCAGCCTGGG + Intronic
1185068924 22:48645702-48645724 CTGCAGACACCCACCACCCATGG - Intronic
949188555 3:1223110-1223132 ATGCACACACACACCATCTAAGG - Intronic
949919635 3:8990733-8990755 CAGCATAGACACACCACCCCGGG - Exonic
950482469 3:13253062-13253084 AAGCAACCTCACACCCACCAGGG - Intergenic
950931018 3:16788915-16788937 AAGCAAACACCTACTTCCCAAGG - Intergenic
952157315 3:30657198-30657220 AAGCAAACACACCACCACCACGG - Intronic
955254218 3:57313233-57313255 AAGCAAGAACAGACCACCTATGG + Intronic
955632874 3:60993559-60993581 AAGGCAATACACACCACCCAGGG + Intronic
956300115 3:67763244-67763266 AAACAAACAAACAAAACCCAGGG - Intergenic
957434070 3:80151793-80151815 AAGCACACACCCTCCACCAAGGG - Intergenic
959980823 3:112515029-112515051 AAGCAAACACACACCATACATGG - Intergenic
961568426 3:127781065-127781087 AATCACACACACACAACCCCAGG - Intronic
962172547 3:133117467-133117489 AAGCCAACAGAAACCTCCCAAGG + Intronic
964007711 3:151851793-151851815 AAGCACACCCACTCCACCAAGGG - Intergenic
964554843 3:157925744-157925766 AAGCAAAAATACACTACACAGGG + Intergenic
965745602 3:171921870-171921892 AAACAAACAAACAAAACCCAAGG + Intronic
968791067 4:2662424-2662446 AAGCAAACACTAAACACCTAAGG + Intronic
968802884 4:2755299-2755321 CAGCATACACACACCCCCCTCGG + Intronic
968886386 4:3336111-3336133 AAACAAACAAACAAAACCCAAGG + Intronic
969916066 4:10492732-10492754 GAGCAAACAGACACCACGCTGGG + Intronic
970555801 4:17231347-17231369 AAGGAAACTCACTCCCCCCAGGG + Intergenic
970996274 4:22270580-22270602 AAGCAAAAACAAAAAACCCAAGG + Intergenic
973185140 4:47318111-47318133 ATGCAAACTCACACCACTTATGG - Intronic
974394335 4:61315303-61315325 AAGCAAATACTTACCATCCATGG - Intronic
975700230 4:77058283-77058305 AGGCAGACACACTCCAGCCAGGG + Intronic
976384266 4:84437287-84437309 AAGCAAACAAACAAAACCCCAGG - Intergenic
976867444 4:89747254-89747276 ACACACACACACACCCCCCAAGG + Intronic
980649455 4:135692103-135692125 AAGAAACCTCACACCAACCATGG + Intergenic
980935107 4:139218914-139218936 AAGCAAACACACACCAACCTGGG + Intergenic
981289128 4:143053439-143053461 AAGCAAACAAACACCACCTCTGG - Intergenic
981712484 4:147722982-147723004 AAACAAACACACAAAATCCAGGG + Intergenic
984490189 4:180424509-180424531 ATGCAAACACACCACACACATGG - Intergenic
985248422 4:187999211-187999233 AGGCAAACCCACCCCACTCACGG + Exonic
985544042 5:500430-500452 CAGGAAACACACACCAAGCACGG + Intronic
985596458 5:793069-793091 AAGCAAACACAGAGCCCACAGGG - Intergenic
986046414 5:4042524-4042546 AAGCAAACACCCACACCCAATGG - Intergenic
987122799 5:14783318-14783340 ACACACACACACACCACACATGG + Intronic
987354889 5:17054815-17054837 AAGCAGACACACAGCATCCTGGG + Intergenic
987887623 5:23831661-23831683 AAGCAAACACCCACCATCCTGGG + Intergenic
988452808 5:31360167-31360189 ACACACACACACACCACCCTAGG - Intergenic
991133636 5:63155661-63155683 AGGCAAAAACACACCACTTAGGG + Intergenic
991462107 5:66870024-66870046 ACACACAAACACACCACCCAAGG - Intronic
993290309 5:86059763-86059785 AAACAAACAAACAAAACCCAGGG - Intergenic
994497015 5:100525830-100525852 AAACACACACACACCCCCCATGG + Intergenic
994953718 5:106499157-106499179 ATACACACACACACCCCCCATGG - Intergenic
995065391 5:107856499-107856521 AAGCAAACACAAATCATCCCTGG - Intergenic
996115052 5:119608994-119609016 CAGCACAGACACACCACCCCTGG - Intronic
996701481 5:126454439-126454461 AAGCAACCAAACAGCTCCCAAGG - Intronic
996867059 5:128136786-128136808 ATGAGAATACACACCACCCAAGG - Intronic
996965853 5:129306543-129306565 AAGCACACACCCTCCACCAAGGG - Intergenic
999253875 5:150198803-150198825 ACACACACACACACCATCCAGGG - Intronic
999915982 5:156261355-156261377 ATACAGACACACACCACACAAGG + Intronic
1000377951 5:160601553-160601575 AAGCAAACACATACCAACTGAGG - Intronic
1000852514 5:166357599-166357621 AAACATACACACACCATCCTGGG - Intergenic
1003268814 6:4589623-4589645 AAGCAAATACACATCACTGAAGG + Intergenic
1003553094 6:7116103-7116125 AAGCAGGCAAACACCACGCACGG - Intronic
1003658015 6:8032165-8032187 CAGCAAACAGACAACACACAGGG + Intronic
1004249343 6:14010640-14010662 TAGAAGACACACACCAACCAGGG - Intergenic
1004840496 6:19578500-19578522 ATGCACACACAGACCACACATGG + Intergenic
1007164721 6:39821301-39821323 AATCAAGCACACCCCACCCCAGG + Intronic
1011587153 6:88938899-88938921 AAGAAAACGCCTACCACCCAAGG - Intronic
1012225479 6:96698906-96698928 AAACAAATACACATCACCCCTGG - Intergenic
1015029497 6:128577309-128577331 AAACACACACACACCTCTCAAGG + Intergenic
1015601686 6:134916746-134916768 AACCACACACACACAAACCATGG + Intergenic
1017368886 6:153680784-153680806 ATGCACACACACACACCCCATGG + Intergenic
1017582679 6:155883594-155883616 TAGCAAACATACACCACAAATGG + Intergenic
1018208049 6:161454067-161454089 AAGCAAGCACAGACCACACATGG + Intronic
1018632962 6:165836133-165836155 CAGCAAGCACAGAGCACCCATGG - Intronic
1018789582 6:167136786-167136808 AACCAAAAATACAACACCCAAGG + Exonic
1018886840 6:167946052-167946074 AAGCAAACACACACCACCCAAGG + Intronic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1020853870 7:13392535-13392557 AAGCAAACACAAAACAACTAGGG - Intergenic
1022109894 7:27222289-27222311 AAACAAACACACAAAACCCAGGG - Intergenic
1022452920 7:30532590-30532612 AGGCATACACACACCACCTTTGG - Intronic
1022569817 7:31441359-31441381 AAGCACACACACACCCCCTCAGG + Intergenic
1024131292 7:46355135-46355157 ATGCACACATACACCACCAATGG + Intergenic
1024628511 7:51229045-51229067 AAGCAAACCCACTCCAGGCAAGG - Intronic
1024940819 7:54761150-54761172 AAGCATATATACACCACCTATGG + Intergenic
1026291019 7:69006210-69006232 AGGCCAACCCACAACACCCAAGG + Intergenic
1026440806 7:70442119-70442141 AAGCAGACAGCCATCACCCAGGG + Intronic
1026830925 7:73609616-73609638 AAACACACACACACCAGCCTGGG - Intronic
1027696118 7:81412480-81412502 ATGCAAACACCAAACACCCATGG - Intergenic
1032000070 7:128259517-128259539 AAGCCAACTCCCCCCACCCAAGG + Intergenic
1032651831 7:133887221-133887243 AACCAAACCCAAACCACCCAAGG + Intronic
1033286229 7:140042852-140042874 AAGCAAACACACATCCCCTCTGG + Intronic
1033452177 7:141471761-141471783 ACGCACACACACACCACTCCAGG - Exonic
1034598295 7:152220695-152220717 AGTCAAACACACACCATCCTGGG + Exonic
1036828175 8:11996106-11996128 CAATAAACATACACCACCCATGG - Intronic
1037178385 8:15973912-15973934 ATGCAAACAACCACCACACAAGG + Intergenic
1038346743 8:26740017-26740039 AGGCATACACACACCAAACATGG + Intergenic
1038357490 8:26842895-26842917 ACACACACACACACCACTCAAGG + Intronic
1038537184 8:28361659-28361681 CAGCACACACACATCAACCACGG + Intronic
1039873757 8:41568150-41568172 GCGCACGCACACACCACCCACGG - Intergenic
1040087971 8:43365418-43365440 ATGTAAACACACACCAGCAAAGG - Intergenic
1041768915 8:61451742-61451764 CAGCAAACACACCCCTCTCATGG - Intronic
1041934744 8:63322606-63322628 GAGCTAACACAAGCCACCCATGG + Intergenic
1042393328 8:68261496-68261518 AAGTAAACACACAGCAATCAAGG - Intergenic
1044038592 8:87337223-87337245 CAGCAAACACCCTCCACCAAGGG - Intronic
1045840015 8:106568828-106568850 AAGCATAAACACACCGTCCAGGG + Intronic
1046171215 8:110509240-110509262 CATCAAATACACACCAACCAAGG - Intergenic
1046211576 8:111082902-111082924 AAACAAACAAAAACCCCCCATGG - Intergenic
1046750089 8:117917902-117917924 AACGTAACACATACCACCCAAGG - Intronic
1047762858 8:127967082-127967104 AAACAAACACTCATTACCCAAGG - Intergenic
1047850308 8:128850212-128850234 ATCCAAATATACACCACCCAGGG + Intergenic
1049124454 8:140774392-140774414 AAGGAAACACTCACCACCAACGG + Intronic
1050088042 9:1987559-1987581 AAACAAACAGAAACCAACCAAGG + Intergenic
1050576509 9:7001884-7001906 AAACAAACAAAAACCACTCATGG - Intronic
1053030918 9:34777315-34777337 ATGCCAGCACACACCAACCAGGG - Intergenic
1053061867 9:35038122-35038144 AGGCACACACACACCACACCTGG - Intergenic
1054327551 9:63721073-63721095 AAGCAAGCCCACACCAGACATGG - Intergenic
1054764317 9:69030611-69030633 AAGCTATCACACACTGCCCAAGG + Intergenic
1055043283 9:71898648-71898670 AAACAAACAAACAACACACATGG + Intronic
1055452854 9:76446331-76446353 GAGCCAGCACACAGCACCCAGGG + Intronic
1056738708 9:89234302-89234324 TTGCTAATACACACCACCCATGG + Intergenic
1056784338 9:89579331-89579353 AAGCAAACACACACAAACCATGG + Intergenic
1057724468 9:97558422-97558444 AAACAAACAAACAGCATCCAGGG - Intronic
1060821816 9:126665642-126665664 TTCCAAAGACACACCACCCAGGG - Intronic
1061214264 9:129211881-129211903 ATGCAGTCACACACCACCCCGGG - Intergenic
1062519107 9:136950305-136950327 AGGCACACACAGACCCCCCAGGG + Intronic
1202794324 9_KI270719v1_random:106602-106624 AAGCAAGCCCACACCAGACATGG - Intergenic
1203493233 Un_GL000224v1:126523-126545 AGGCAAACACTCAGTACCCAAGG - Intergenic
1203505853 Un_KI270741v1:68398-68420 AGGCAAACACTCAGTACCCAAGG - Intergenic
1185747057 X:2582234-2582256 ACGCAAGCACATCCCACCCAGGG - Intergenic
1185952335 X:4450924-4450946 AAGCAAAGGCACACCTCACATGG - Intergenic
1186600748 X:11034300-11034322 AACCAGCCCCACACCACCCAGGG - Intergenic
1187401207 X:18962021-18962043 AATTACACACACACCACCCTAGG - Intronic
1187635915 X:21228092-21228114 AAGAAAACTGACACCACCCTCGG + Intergenic
1187893883 X:23963109-23963131 AAGCAAACTCACACCAGCATCGG - Intergenic
1188663727 X:32792099-32792121 AAGAAAACAACCACCAGCCAAGG + Intronic
1188833956 X:34933538-34933560 AAACAAACAAAAAACACCCAAGG + Intergenic
1190238110 X:48632863-48632885 AAACAGACACCCAACACCCAAGG + Intergenic
1190711231 X:53072106-53072128 CAGCAAACAAACACAACCCTGGG - Intronic
1195749325 X:108148534-108148556 ACACACACACACACCACCCATGG + Intronic
1195998549 X:110756712-110756734 AAACAAACCCAAAACACCCATGG + Intronic
1200042986 X:153383343-153383365 ATGAAAACACACAACACACATGG + Intergenic
1201148994 Y:11084824-11084846 AAGCAAGCCCACACCAGACATGG + Intergenic
1201557501 Y:15279381-15279403 AAGCAAAAACACATCTCACATGG + Intergenic
1201603322 Y:15756190-15756212 AACCAAACACAAACAACCAAGGG + Intergenic