ID: 1018888676

View in Genome Browser
Species Human (GRCh38)
Location 6:167964658-167964680
Sequence GTGTAGCTCTAGAGGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018888676 Original CRISPR GTGTAGCTCTAGAGGGAGTA GGG Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
908990659 1:70084319-70084341 GTCTAGGGCTGGAGGGAGTATGG - Intronic
918444871 1:184607331-184607353 GTGTGGATCTAGAGTGAGTTTGG + Intronic
919046716 1:192461885-192461907 GTGGAGATCTAGAAGGAGCATGG + Intergenic
920781709 1:208998099-208998121 GTTGACCTCTAGAGGGAGTAGGG - Intergenic
921967434 1:221105352-221105374 GTGGAGGTATAGAGGGAGTGGGG + Intergenic
922564154 1:226590316-226590338 GAGTGGCTCTACAGGGAGTCGGG - Intronic
922845772 1:228682813-228682835 TTGTAATTCTAAAGGGAGTATGG + Intergenic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065603542 10:27393379-27393401 GGGTCCCTCTAGAGGCAGTAGGG - Intergenic
1066389066 10:34964304-34964326 GTGTGGCTAAAGAGGGAGCAAGG + Intergenic
1067019975 10:42786811-42786833 TTGTAGCTCTAGTGGGAATACGG + Intronic
1070088260 10:73257625-73257647 GTGTAGATTTGGAGGAAGTAAGG - Intronic
1070405116 10:76087569-76087591 GTGTAGCTGTAGAGAGAGATGGG + Intronic
1070689886 10:78516631-78516653 GTGGAGCTCTAGACGCAGTTGGG - Intergenic
1081704057 11:45170437-45170459 GTGAATGCCTAGAGGGAGTAGGG + Intronic
1088311502 11:108465653-108465675 GTGTAGCTAGAGAGTGAGAATGG + Intronic
1100391648 12:94149710-94149732 GTGTAGTTGTAGGGGTAGTAGGG - Exonic
1102164645 12:110796670-110796692 GTGTGGCAAGAGAGGGAGTAGGG + Intergenic
1102956233 12:117060844-117060866 GTGGAGCTCCAGAGGGAATCTGG + Intronic
1103575945 12:121877334-121877356 GAGGGGCTCTAGAGGCAGTAAGG - Intergenic
1106097255 13:26659201-26659223 GTGTAGAGCTAGAGGAAGTGAGG + Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1110178020 13:72580602-72580624 GTGTAGCTCTGGAAGGAGCCTGG - Intergenic
1112804221 13:103145187-103145209 GTTTTACTCTAGAGAGAGTATGG - Intergenic
1117960955 14:61160887-61160909 GTGTAGCTCTATTTGGAGTAAGG + Intergenic
1119950079 14:78736079-78736101 GTGTAGCTGTATAGGGGATAGGG - Intronic
1125361896 15:38873214-38873236 GTGGGGCACTAGAGGGAGTCTGG - Intergenic
1130657917 15:85805184-85805206 GAGTAGATCTAGAGAGAGAAGGG + Intergenic
1131336146 15:91551306-91551328 GAGTAGATCTAGAGGGACAAAGG - Intergenic
1132144794 15:99423318-99423340 GTGTAGCTCTGGAGGGAGTGGGG - Intergenic
1135472365 16:22742804-22742826 GTGTGGCTCTTGAGGGGGCAGGG - Intergenic
1140912409 16:79466208-79466230 GGGTGGGTCTAGAGGGAGTGAGG - Intergenic
1144117421 17:12111960-12111982 GTGCAGCTCTGTAGGGAGTATGG + Intronic
1144157310 17:12518412-12518434 GTGTAGCTCTGGAGGCTGGATGG - Intergenic
1148227992 17:45912551-45912573 TTGGAGCTCCAGAGGGAGTGTGG + Intronic
1152697178 17:81803273-81803295 ATGTGGCTCTAGGGGGAGTGAGG + Intergenic
1152942414 17:83179742-83179764 GAGTAGCTCTTGCGGGAGAAAGG - Intergenic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1159355157 18:67330058-67330080 GTGTATTTCTAGAGAGAGTTTGG + Intergenic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1162444990 19:10717494-10717516 GTGTCGCCCTTGAGCGAGTACGG + Intergenic
926049790 2:9737516-9737538 GAGGAGTACTAGAGGGAGTAGGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
932135552 2:69225726-69225748 GTGAAGCTGGAGAGGGAGTTTGG - Intronic
933381588 2:81554228-81554250 TTGTACCTCTAGAGGGAGAGGGG + Intergenic
933583101 2:84149644-84149666 TTGCAGCTCTAGAGGGAGGCTGG + Intergenic
934856198 2:97731915-97731937 GTGTAGCTTTACAGTGAGGAGGG - Intronic
939981536 2:148788149-148788171 GAGTAACTCCAGAGGTAGTATGG - Intergenic
942851584 2:180494291-180494313 TAGAAGCTATAGAGGGAGTAGGG + Intergenic
946591967 2:221259933-221259955 GTGGAGCTCTGGAGAGAGCATGG + Intergenic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1170615415 20:17945213-17945235 GTGTAGGTCTAGAGGAAGGCAGG - Intronic
1175209842 20:57346776-57346798 GTGTAGCTTTACAGGGAATTGGG - Intergenic
1177928726 21:27252050-27252072 GAGAAGCTCTCTAGGGAGTATGG + Intergenic
949647865 3:6118612-6118634 GTATAGCTTGAGAGGAAGTATGG + Intergenic
953210152 3:40868471-40868493 GGGTAGCTGCAGAGGGAGAATGG - Intergenic
960117788 3:113913908-113913930 GTGTGGGTTTAGAGGGAGTGAGG + Intronic
961599488 3:128049045-128049067 ATGTAATTCTAGAGAGAGTATGG - Intergenic
963427442 3:145149615-145149637 GTCTAGGTCTAGAGGCAGAATGG + Intergenic
965372367 3:167879491-167879513 GTGTTGCTCTATTTGGAGTAAGG + Intergenic
965460548 3:168956685-168956707 CTGTATCTGTAGTGGGAGTAAGG - Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
972363906 4:38355483-38355505 GAGCAGCTTTGGAGGGAGTAGGG + Intergenic
982907439 4:161092585-161092607 GTATAGCTCTAGAGGCAGGAAGG + Intergenic
986470453 5:8068496-8068518 GTGGGGCTAGAGAGGGAGTATGG + Intergenic
987396192 5:17426432-17426454 GTGGAGCTGGTGAGGGAGTAGGG - Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988617274 5:32786814-32786836 CTCCAGCTCTAGAGAGAGTAAGG - Exonic
992208113 5:74450972-74450994 TTGTAGCTGTAGAGGGAGTGTGG + Intergenic
993637190 5:90358883-90358905 GTGTAGATCTGGAGAGATTAGGG + Intergenic
995536872 5:113145379-113145401 TTGTAGCCCTAGACGGAATATGG - Intronic
998581038 5:143376414-143376436 AGGTAGCTCTAGATGGAGAAGGG - Intronic
1002052076 5:176576940-176576962 GAGTAACTCTGGAGGGTGTATGG + Intronic
1004311190 6:14546701-14546723 AAGTCGCTCTAGAAGGAGTACGG - Intergenic
1007918030 6:45579330-45579352 GTGGAGCTCTAGAAGGCCTAGGG + Intronic
1008059165 6:46978607-46978629 GTGTAGCCTTAGGGGGAGTGAGG - Intergenic
1014845176 6:126267089-126267111 GTGGAACTCTAGAAGGAATATGG + Intergenic
1014857000 6:126415143-126415165 GTGTAACTCAAGGGGGTGTAAGG + Intergenic
1018069202 6:160146955-160146977 GTGTAGTTCTCTAGGGAGAAAGG + Intronic
1018888676 6:167964658-167964680 GTGTAGCTCTAGAGGGAGTAGGG + Intronic
1025741292 7:64198491-64198513 GTGCAGCATGAGAGGGAGTATGG - Intronic
1030744709 7:113151250-113151272 CTGTAGGTCTAGAGGTACTATGG + Intergenic
1034211832 7:149370485-149370507 GTGTTGCTCTAGATGAAGTGTGG - Intergenic
1036702889 8:11024859-11024881 GTGTAACTCTGGGAGGAGTAGGG - Intronic
1037510662 8:19578652-19578674 GTATAGGTCTAGAGGGAGGTGGG - Intronic
1041057901 8:54006589-54006611 GTGTAGAGTTAGAGAGAGTATGG - Intronic
1041582355 8:59476047-59476069 GTGTAGGTTTAAAGGGAGTATGG + Intergenic
1045063190 8:98425727-98425749 GTGTAGCTCTGGAGGGCTTGGGG - Intronic
1047917434 8:129597098-129597120 GCTTAGGGCTAGAGGGAGTAGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1060698885 9:125733064-125733086 GTGAAGATCAAGAGGAAGTAGGG + Intergenic
1187705796 X:22008177-22008199 GTGTAGCCCAGGAGGCAGTAAGG + Intergenic
1190366045 X:49695760-49695782 GTGTGGCTTTTGAGGGAGAAGGG - Intronic
1197156607 X:123276795-123276817 GTACAGCTCTAGAGGCAGTAGGG - Intronic
1199136409 X:144258716-144258738 GTGGAGTACTAGATGGAGTAGGG - Intergenic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1201303076 Y:12526963-12526985 GAGTAGCTTTGGAGGGAGTAGGG - Intergenic