ID: 1018891727

View in Genome Browser
Species Human (GRCh38)
Location 6:167987681-167987703
Sequence CCTCGAAGGCCCCACAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018891717_1018891727 16 Left 1018891717 6:167987642-167987664 CCACCATCACCACAAGCCAGGTG No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
1018891723_1018891727 -8 Left 1018891723 6:167987666-167987688 CCGGTGTCTCCATCACCTCGAAG No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
1018891722_1018891727 -7 Left 1018891722 6:167987665-167987687 CCCGGTGTCTCCATCACCTCGAA No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
1018891718_1018891727 13 Left 1018891718 6:167987645-167987667 CCATCACCACAAGCCAGGTGCCC No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
1018891715_1018891727 25 Left 1018891715 6:167987633-167987655 CCACAGCAGCCACCATCACCACA No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
1018891720_1018891727 7 Left 1018891720 6:167987651-167987673 CCACAAGCCAGGTGCCCGGTGTC No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
1018891721_1018891727 0 Left 1018891721 6:167987658-167987680 CCAGGTGCCCGGTGTCTCCATCA No data
Right 1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018891727 Original CRISPR CCTCGAAGGCCCCACAAGCC AGG Intergenic