ID: 1018891738

View in Genome Browser
Species Human (GRCh38)
Location 6:167987719-167987741
Sequence TCACCCCGAAGGGCCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018891730_1018891738 5 Left 1018891730 6:167987691-167987713 CCCACAAGCCAGGTGCCCGGCAT No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891726_1018891738 15 Left 1018891726 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891731_1018891738 4 Left 1018891731 6:167987692-167987714 CCACAAGCCAGGTGCCCGGCATC No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891725_1018891738 21 Left 1018891725 6:167987675-167987697 CCATCACCTCGAAGGCCCCACAA No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891732_1018891738 -3 Left 1018891732 6:167987699-167987721 CCAGGTGCCCGGCATCTCCATCA No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891733_1018891738 -10 Left 1018891733 6:167987706-167987728 CCCGGCATCTCCATCACCCCGAA No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891729_1018891738 6 Left 1018891729 6:167987690-167987712 CCCCACAAGCCAGGTGCCCGGCA No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data
1018891723_1018891738 30 Left 1018891723 6:167987666-167987688 CCGGTGTCTCCATCACCTCGAAG No data
Right 1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018891738 Original CRISPR TCACCCCGAAGGGCCCCCGC CGG Intergenic
No off target data available for this crispr