ID: 1018891965

View in Genome Browser
Species Human (GRCh38)
Location 6:167989158-167989180
Sequence CTTCTCCAGCAGAACGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018891959_1018891965 2 Left 1018891959 6:167989133-167989155 CCTCGCCATCACATTCCACCAAA No data
Right 1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG No data
1018891956_1018891965 23 Left 1018891956 6:167989112-167989134 CCTGAGCTTGCAGAGGTAACCCC No data
Right 1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG No data
1018891957_1018891965 4 Left 1018891957 6:167989131-167989153 CCCCTCGCCATCACATTCCACCA No data
Right 1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG No data
1018891958_1018891965 3 Left 1018891958 6:167989132-167989154 CCCTCGCCATCACATTCCACCAA No data
Right 1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG No data
1018891960_1018891965 -3 Left 1018891960 6:167989138-167989160 CCATCACATTCCACCAAAGCCTT No data
Right 1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018891965 Original CRISPR CTTCTCCAGCAGAACGTGGA CGG Intergenic
No off target data available for this crispr