ID: 1018892328

View in Genome Browser
Species Human (GRCh38)
Location 6:167990748-167990770
Sequence GAGTCACACGTGGGCATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018892322_1018892328 2 Left 1018892322 6:167990723-167990745 CCCGAGCTCACACGCGGGCATCG No data
Right 1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG No data
1018892316_1018892328 30 Left 1018892316 6:167990695-167990717 CCCGGAGGCACCGCAGGCAGCGC No data
Right 1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG No data
1018892317_1018892328 29 Left 1018892317 6:167990696-167990718 CCGGAGGCACCGCAGGCAGCGCG No data
Right 1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG No data
1018892323_1018892328 1 Left 1018892323 6:167990724-167990746 CCGAGCTCACACGCGGGCATCGC No data
Right 1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG No data
1018892318_1018892328 20 Left 1018892318 6:167990705-167990727 CCGCAGGCAGCGCGCGACCCCGA No data
Right 1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG No data
1018892321_1018892328 3 Left 1018892321 6:167990722-167990744 CCCCGAGCTCACACGCGGGCATC No data
Right 1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018892328 Original CRISPR GAGTCACACGTGGGCATCCC GGG Intergenic
No off target data available for this crispr