ID: 1018896097

View in Genome Browser
Species Human (GRCh38)
Location 6:168018654-168018676
Sequence CCAGGGTGGTAGGAGAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018896090_1018896097 3 Left 1018896090 6:168018628-168018650 CCTCGGCACTGGGTCGTGGTGTA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1018896097 6:168018654-168018676 CCAGGGTGGTAGGAGAGCCCCGG 0: 1
1: 0
2: 1
3: 34
4: 437
1018896088_1018896097 7 Left 1018896088 6:168018624-168018646 CCTTCCTCGGCACTGGGTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1018896097 6:168018654-168018676 CCAGGGTGGTAGGAGAGCCCCGG 0: 1
1: 0
2: 1
3: 34
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018896097 Original CRISPR CCAGGGTGGTAGGAGAGCCC CGG Intronic
900154410 1:1198240-1198262 ACAGGGCGGCAGGAGGGCCCAGG - Intergenic
900224994 1:1528836-1528858 CCATGGGGGTGGGGGAGCCCAGG - Intronic
900306520 1:2011824-2011846 CCAGGGTGGAAGGGGAGCCAGGG + Intergenic
900391368 1:2435391-2435413 CCAGGGTGGTGTGAGAGCGCTGG - Intronic
900461258 1:2803046-2803068 CCAGGGCTGTAGAAGAGCCCGGG + Intergenic
900544198 1:3219482-3219504 CCAGCGTGGGAGGAGAGCGCAGG + Intronic
900905325 1:5552940-5552962 CCAGGTGGAGAGGAGAGCCCAGG + Intergenic
900906639 1:5564121-5564143 CAAACGTGGTAGGTGAGCCCTGG - Intergenic
901258871 1:7856591-7856613 CCCTGCTGGCAGGAGAGCCCAGG + Intergenic
901610803 1:10496391-10496413 TCATGGTGGTGGGAAAGCCCAGG + Intronic
901795376 1:11676628-11676650 CCTGGGTGGGGGCAGAGCCCAGG - Intronic
901850225 1:12010424-12010446 CCAGGCTAGGAGGGGAGCCCAGG + Intronic
901916436 1:12504012-12504034 TCAGGGTGGTAAGAGAAGCCTGG - Intronic
902310613 1:15578885-15578907 CCAAGGTCGTGGAAGAGCCCCGG + Exonic
902913666 1:19621763-19621785 TGAGGTGGGTAGGAGAGCCCAGG + Intronic
903212918 1:21828755-21828777 CCAAGGTGCTTGGAGAGCCGAGG + Intronic
903278426 1:22236319-22236341 CCAGGCTGGTACTGGAGCCCAGG - Intergenic
903285896 1:22276451-22276473 CTAGGATGCTAGGAGAGCACTGG + Intergenic
903845869 1:26279807-26279829 CCTGGGTGGCAGGACAGGCCCGG - Exonic
904788352 1:32999104-32999126 CCAGGGTGTCTGGAGACCCCAGG + Intergenic
904896881 1:33824309-33824331 ACAGGGTGCTAGGAGAGCCCAGG - Intronic
905085110 1:35367301-35367323 CCAGGGTGGTGGGAGGGCAGAGG - Intronic
905323569 1:37134370-37134392 CCAGGCAGGTAGGAGAGGGCTGG - Intergenic
905694263 1:39963224-39963246 CCAGGGTGGCAGTGCAGCCCCGG - Intronic
906153145 1:43599461-43599483 CCAGTGGGGTAAGACAGCCCTGG - Intronic
906949999 1:50326809-50326831 CCAGGGTGGCAGTGCAGCCCCGG - Intergenic
907403407 1:54239539-54239561 GTAGGGTGGTGGGAGAGCACAGG - Intronic
908351354 1:63288436-63288458 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
909538478 1:76765120-76765142 CCCGGGTGGCAGCAGAGCTCTGG - Intergenic
911324912 1:96459920-96459942 CCAGGGTGGTCTCAAAGCCCAGG - Intergenic
912451885 1:109772484-109772506 CCAGGGTGGCAGAAGAGCTGGGG - Intronic
912490629 1:110060843-110060865 CCAGGGTGGGGGGAAAGCCATGG + Exonic
915897012 1:159819936-159819958 CCATGGTGCCAGGAGATCCCTGG - Intergenic
916102768 1:161406883-161406905 CCAGGGTGGCAGTGCAGCCCTGG - Intergenic
916841383 1:168604766-168604788 CAAGGCTGGTATGAGATCCCTGG + Intergenic
918259072 1:182777799-182777821 CCAGAGTGGGTGGAAAGCCCAGG - Intergenic
918676880 1:187297488-187297510 CCAGGGTGGTAGAAATGCCTTGG - Intergenic
919057785 1:192592205-192592227 CAAGGGTGATAGGCCAGCCCTGG - Intergenic
919704467 1:200663188-200663210 CTAGGGTGGTAGGGCGGCCCTGG - Intronic
919905471 1:202075526-202075548 CCAGGGTGTAGGGAGGGCCCTGG + Intergenic
920275876 1:204803790-204803812 CCAGGGTGCTAGGAGAACAGAGG - Intergenic
920373768 1:205495430-205495452 CCAAGGTCATGGGAGAGCCCTGG + Intergenic
922069372 1:222175670-222175692 CCAGTGTTGGAGGTGAGCCCTGG - Intergenic
922469746 1:225868795-225868817 CCAGGGTGGTAGGATGGACTGGG - Intronic
923908482 1:238412970-238412992 GCAAGGTGGGAGGAGATCCCTGG + Intergenic
924626689 1:245701778-245701800 CCAAGGTGGTGGGATGGCCCTGG - Intronic
1064134286 10:12737127-12737149 CGAGGGTGGGAGGAAGGCCCAGG - Intronic
1067217754 10:44316746-44316768 TGAGGGTGGTGGGAGGGCCCAGG - Intergenic
1070972551 10:80579527-80579549 CCGGGGTGGAAGAAGAGCACAGG - Intronic
1072199082 10:93142777-93142799 CCAAGGTGGTAGGAAGACCCAGG + Intergenic
1074260910 10:111852236-111852258 CCAGTGGAGCAGGAGAGCCCTGG - Intergenic
1074290829 10:112137037-112137059 GCAGTGTGGGAGTAGAGCCCCGG - Intergenic
1074780433 10:116798301-116798323 CCAGGGTGGAGGGAGCTCCCAGG + Intergenic
1075088800 10:119431345-119431367 CCAGGGTGGCAGGAGCACCGTGG - Intronic
1076156548 10:128210069-128210091 CCCGCGTGGGAGGAGAGCCTGGG + Intergenic
1076624080 10:131810982-131811004 ACAGGGTGGGAGGAAGGCCCTGG - Intergenic
1076825833 10:132967554-132967576 CCAGGGCAGTTGGAGAGACCAGG - Intergenic
1076912964 10:133401538-133401560 CCAGGGTGGGTGGCGAGCCTGGG + Exonic
1077078629 11:712779-712801 CCAGGCTGCTGGGAGGGCCCTGG - Intronic
1077164102 11:1127384-1127406 CCCGGGTGGTGGGAAAGGCCCGG - Intergenic
1077164887 11:1130563-1130585 CCAGGGTGCTGGGAGAACCTGGG + Intergenic
1077459760 11:2703122-2703144 GCAGGCTGGGAGGTGAGCCCAGG + Intronic
1077557612 11:3233361-3233383 CCAGAGCGGTGGCAGAGCCCAGG - Intergenic
1077602381 11:3582413-3582435 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1078859138 11:15231116-15231138 CCAGAGAGGCAAGAGAGCCCAGG - Intronic
1079058686 11:17228947-17228969 CCAGGGTGGCAGTGCAGCCCCGG - Intronic
1079319851 11:19442678-19442700 GCAGGGTGGAACCAGAGCCCTGG - Intronic
1080044911 11:27798658-27798680 TCAGGGTTGGAGGAGAGGCCTGG + Intergenic
1080643631 11:34173125-34173147 CCAGGGAGGAGGGAGGGCCCCGG - Intronic
1080658930 11:34280323-34280345 GCAGGCTGGTAGCAGAGCCATGG - Intronic
1081369109 11:42276828-42276850 CCAGTGTTGGAGGTGAGCCCTGG - Intergenic
1081758255 11:45559796-45559818 CAAGGGTTGAAGGAGAGTCCAGG - Intergenic
1083024650 11:59540287-59540309 CCAGGGTTGGAGGAGGGACCTGG - Intergenic
1083718605 11:64592925-64592947 CCAGGGTCCTAGGAGAGCAGGGG - Intronic
1084041125 11:66543320-66543342 CCAGATTGGTAGGGGAGGCCTGG - Intronic
1084258275 11:67956960-67956982 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1084359720 11:68661552-68661574 CCAGGGTGGAAGGAGAATTCGGG - Intergenic
1084426315 11:69086198-69086220 CCATGGGGGTGGGGGAGCCCCGG + Intronic
1084590018 11:70085114-70085136 CCAGCAGGGCAGGAGAGCCCGGG - Intronic
1084711074 11:70844059-70844081 CCAAGGTGGTGGGAGCTCCCTGG + Intronic
1084814471 11:71638250-71638272 CCAGGAAGGCAGGAGAGGCCAGG - Intergenic
1085260917 11:75204213-75204235 CCTGGGTGGGAGCAGAGGCCTGG - Intronic
1088561212 11:111118180-111118202 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
1089332072 11:117696581-117696603 CCAGGGTGGGTGTAGATCCCAGG + Intronic
1089461429 11:118656463-118656485 CCAGGGAGTTTAGAGAGCCCAGG + Intronic
1089729044 11:120509286-120509308 CCATGGTGGTCGGAGCGCACAGG - Intergenic
1090391897 11:126394233-126394255 CCTGGGAGGGAGGAGCGCCCGGG + Intronic
1090756679 11:129797970-129797992 CCAGGGTAGTAGGAGATAGCTGG - Intergenic
1091189092 11:133674971-133674993 CCAAGGTGCAAGGAGAGCCAGGG - Intergenic
1091202712 11:133794400-133794422 CCAGGGTGCTGGGGGAGCCATGG - Intergenic
1091222790 11:133939110-133939132 CCAGTGTGGTTGGAGTGCGCTGG - Intronic
1091390572 12:123818-123840 CCAGGGTGGTGGGGTGGCCCTGG - Intronic
1091584960 12:1810913-1810935 CCTGGGTGGTGGAAGGGCCCAGG + Intronic
1092106567 12:5925723-5925745 GCAGCGTGGAAGGAGAGCCAAGG - Intronic
1092164942 12:6336835-6336857 CCAGGGTGGGAGGGCAGCCTTGG - Intronic
1092796414 12:12114346-12114368 CCAGGCTGGTTGGAGTGCCAAGG + Intronic
1092883448 12:12905908-12905930 CCAGGAGGATAGGAGATCCCAGG - Intronic
1093315710 12:17647389-17647411 CCAGTGTTGAAGGAGGGCCCTGG + Intergenic
1093963732 12:25303399-25303421 CCAGGGAAGTGGGAGAACCCCGG - Intergenic
1095728193 12:45474854-45474876 CCAGGGTTGGAGGTGAGGCCTGG + Intergenic
1095930419 12:47619957-47619979 CCAGGGTGGCATCAGAGACCTGG + Intergenic
1096522304 12:52191324-52191346 CCTGGGTGGTGGGTGACCCCAGG + Intronic
1096981163 12:55728833-55728855 CCAGGGCGGCTGGAGAGCGCCGG + Intronic
1099869384 12:88327377-88327399 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1100214422 12:92433125-92433147 CCAGTGTGGGAGGAGGGGCCTGG - Intergenic
1100691865 12:97046929-97046951 CCAAGGTGCTATGAAAGCCCAGG - Intergenic
1100979494 12:100153601-100153623 CCTGGGTGGTCAGAAAGCCCAGG - Intergenic
1101319625 12:103662078-103662100 CCAGGGTGGTAGCAGGGACATGG + Intronic
1102217346 12:111170849-111170871 CCAGCGTGGTAGGAAGGCCGAGG + Intronic
1103107961 12:118246761-118246783 CCAGGGTGGCAGTGCAGCCCCGG - Intronic
1104411908 12:128565287-128565309 TCCAGGTGGTAGGAGAGGCCGGG - Intronic
1104657163 12:130581919-130581941 CCAGGGAGGGAGGAGAGGCCAGG - Intronic
1106138403 13:26991404-26991426 ACAGGGTGCCAGGAGACCCCAGG - Intergenic
1106758017 13:32841431-32841453 CTAGGAAGGTAGGAGAGGCCTGG + Intergenic
1113480429 13:110616052-110616074 CGAGGACGGTAGGAGGGCCCTGG + Intronic
1113557729 13:111252010-111252032 CCAAAGTGGGAGGAGTGCCCTGG + Intronic
1113926861 13:113946607-113946629 CCAGGGTGAAAGGAGGGCACTGG + Intergenic
1119403112 14:74377905-74377927 CCAGGGTGGCAGTGCAGCCCTGG + Intergenic
1119602542 14:75986162-75986184 ACAGGGTGATAGGGGAGCCCCGG + Intronic
1120670160 14:87353970-87353992 CAAGTGTCGTGGGAGAGCCCTGG - Intergenic
1120915471 14:89706430-89706452 CCAGGGTTGGAGGTGAGACCTGG - Intergenic
1121353693 14:93195182-93195204 CCAGGCTGGTCTCAGAGCCCTGG + Intronic
1121456886 14:94044065-94044087 CCAGTGTGGAAGGAGGGACCAGG - Intronic
1121617383 14:95321555-95321577 CCAGGGTGGTAGTAGCAGCCAGG + Intergenic
1121908267 14:97767076-97767098 CTGGGGTGGTCAGAGAGCCCAGG - Intergenic
1122797110 14:104211512-104211534 CCAGGGAGGAGGCAGAGCCCAGG + Intergenic
1122855649 14:104558838-104558860 CAAGGGTGGTGGGAGAGGCGGGG + Intronic
1122912165 14:104836176-104836198 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1123219714 14:106844350-106844372 CCGGGGTGGGAGGACAGCCAGGG - Intergenic
1123711626 15:22992127-22992149 CCAGGGAGGAAGTTGAGCCCTGG - Intronic
1124215661 15:27805679-27805701 TGAGGGTGGCAGGGGAGCCCTGG + Intronic
1125041723 15:35195675-35195697 CCAGGTTGGTAAAAGTGCCCTGG + Intergenic
1125334548 15:38614601-38614623 CCTGGGTAGTAGAAGAGCACTGG - Intergenic
1127843146 15:62847422-62847444 CCAGGGTGGTCTGAGATCTCTGG - Intergenic
1127882740 15:63172490-63172512 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1127893876 15:63277767-63277789 CCAGCGGGGGAGGGGAGCCCCGG - Intronic
1128768951 15:70267565-70267587 CCAGGTTGTCAGGAGAGCCCAGG - Intergenic
1129709631 15:77813974-77813996 CCTAGGGGGCAGGAGAGCCCAGG - Intronic
1129753860 15:78084219-78084241 CCAAGATGGTCTGAGAGCCCTGG - Intronic
1130223672 15:82043071-82043093 CCAGGGAGGCAGGCGAGCGCTGG + Exonic
1131014091 15:89043218-89043240 CTAGGGTGCTAGAAGAGCTCAGG - Intergenic
1131051258 15:89349556-89349578 CCAGCGGGGCAGGAGAGTCCCGG + Intergenic
1131605832 15:93901273-93901295 CCAGGGTGGGTGGAGGGCCGGGG - Intergenic
1131770069 15:95727626-95727648 CCAGTGTTGGAGGAGGGCCCTGG - Intergenic
1131885000 15:96903069-96903091 CTTGGGTGGGAGGAGAGCCTGGG - Intergenic
1131905371 15:97136489-97136511 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1132465272 16:74581-74603 CCAGGGTGGGCTGAGAGCCTGGG - Intronic
1132533697 16:466897-466919 GCAGTGAGATAGGAGAGCCCTGG - Intronic
1132553467 16:563057-563079 CCAGGGTGGCAGCAAAGTCCAGG - Intronic
1132576523 16:666834-666856 CCAGGGTGGTGGGTGGGGCCTGG + Intronic
1132837657 16:1962506-1962528 CCAGGGTGGCAGTGCAGCCCCGG + Exonic
1133369695 16:5238601-5238623 CCAGGAAGGCAGGAGAGCCCAGG - Intergenic
1134093303 16:11402952-11402974 CCAAGATGGAAGGAGAGCACAGG - Intronic
1134799175 16:17068844-17068866 GCAGGGTGCTGGGAGAGCCTTGG + Intergenic
1135409124 16:22219924-22219946 GCAGGTTGGAAGGAGAGCCAAGG + Intronic
1135681996 16:24465373-24465395 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1137565778 16:49531708-49531730 CCAGGGTCATAGGAGAACTCAGG + Intronic
1137986593 16:53113933-53113955 CCAAGGTGGGAGGTGAGGCCAGG - Intronic
1138552663 16:57755977-57755999 ACAGGGAGCTAGGAGAGGCCAGG - Exonic
1139067532 16:63336741-63336763 CCAGTGTGGGAGGAGGGACCTGG - Intergenic
1139373721 16:66484038-66484060 CAAGGGTGGAAGAAAAGCCCAGG - Intronic
1139678156 16:68539526-68539548 GCAGGGTGGTGGGCGAGGCCCGG - Intronic
1140393525 16:74608148-74608170 CCAGGGTGGTGGGAAGCCCCAGG - Intergenic
1140419607 16:74807587-74807609 GCAGGGTTGGAGCAGAGCCCTGG - Intergenic
1140478693 16:75251321-75251343 CCAGGGCAGAAGGAGATCCCAGG + Intronic
1141517482 16:84555535-84555557 CCAGGGTGGGAGGCGGGCTCGGG + Intergenic
1141950902 16:87338747-87338769 CCAGGGAGGTTGGAGGGGCCAGG - Intronic
1142227217 16:88883405-88883427 CCAGCGTGTTCCGAGAGCCCTGG - Intronic
1142276199 16:89120147-89120169 CCGGGGTGGGGGCAGAGCCCAGG - Intronic
1143011665 17:3869472-3869494 CCACGGTGGTAAGAGAGCCGGGG - Exonic
1143730873 17:8882012-8882034 CCAGGGTGGTACAGGGGCCCTGG - Intronic
1143882561 17:10040746-10040768 GCAGTGTGGGAGGAGAGGCCGGG + Intronic
1144078149 17:11737392-11737414 CCAGGGTGCTAGAAGAGCAAAGG - Intronic
1144379131 17:14675691-14675713 CCAGGGTGCTAAGGAAGCCCTGG + Intergenic
1144672616 17:17141510-17141532 GCAGGGAGGAAGCAGAGCCCGGG + Intronic
1144703657 17:17353859-17353881 CCTAGGTGGGAGGAGAGCCTCGG + Intergenic
1144856543 17:18271554-18271576 CCAGGGTGGCAGAAGAGGCCAGG + Intronic
1145022899 17:19446152-19446174 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1145768384 17:27475156-27475178 CCAGGGTTGTTGGAAAACCCTGG + Intronic
1145776360 17:27531762-27531784 CCAGGGTGGGAGGTGAACCTAGG - Intronic
1145961378 17:28888244-28888266 TGAGGGTGGCAGGAGAGGCCAGG + Intronic
1147170242 17:38614278-38614300 CATGGGTGTTAGGAAAGCCCAGG - Intergenic
1147596080 17:41718417-41718439 CCAGGGGGGCAGGAGAAGCCGGG - Intronic
1148101858 17:45097124-45097146 GCCGGGTGGCCGGAGAGCCCTGG - Exonic
1148151208 17:45397276-45397298 CCAGGTGGGTAGGAGTCCCCAGG - Intronic
1148897636 17:50849036-50849058 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1149166268 17:53757171-53757193 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1149342549 17:55701479-55701501 CCAGTGTTGGAGGAGAGACCTGG - Intergenic
1149682802 17:58517637-58517659 CCAGGTTGGCAGGGGAGCCCAGG + Intronic
1150543359 17:66127378-66127400 CCAGTGTGGGAGAAGAGCACAGG - Intronic
1151195031 17:72425254-72425276 CCAGTGTTGTGGGAGAGACCTGG + Intergenic
1152161530 17:78671358-78671380 TCAGAGAGGTAGGAGAGCCCAGG + Intergenic
1152225557 17:79091078-79091100 CCAGGATGGGAGGAGACACCTGG + Intronic
1152573149 17:81129207-81129229 CCTGGCTGCCAGGAGAGCCCAGG + Intronic
1152874743 17:82780177-82780199 CCAGGGAAGCAGGAGAGCCAGGG - Intronic
1153612478 18:6900040-6900062 CCCTGGTGGCAGCAGAGCCCAGG + Intronic
1155351498 18:24911779-24911801 CCAGGGTGCTCCAAGAGCCCAGG - Intergenic
1155812721 18:30258781-30258803 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
1156740521 18:40321907-40321929 CCAATGTGGTAGGAGACGCCTGG + Intergenic
1157825274 18:50806649-50806671 CCAAGGTGGTTGGAGAGGCTTGG + Intronic
1158508314 18:58066911-58066933 CCAGTGTTGTAGGAGGGGCCTGG - Intronic
1159944780 18:74436319-74436341 CCAGGGTGGGACGAGAGCGAGGG + Exonic
1160015839 18:75139752-75139774 ACAGCGTGGGAGGAGGGCCCGGG - Intergenic
1160153361 18:76412385-76412407 CCAGGAGGGGAGGAGAGCCTTGG - Intronic
1161315907 19:3617574-3617596 CCAGGCTTATAGGAGAGGCCGGG + Intronic
1161417765 19:4157202-4157224 CCAGGATGATAGGAGAGGCAGGG - Exonic
1161443544 19:4305365-4305387 CCAGGGAGGTGGGATAGCCTGGG - Intronic
1161602112 19:5190624-5190646 ACAGGGTGGGAGGAGAGCTTTGG + Intronic
1161901528 19:7123041-7123063 CCAGGGAGGGAGGAGAACCCTGG - Intronic
1162901171 19:13796103-13796125 CCAGGGTTGTAGGCGGGCCATGG - Intronic
1163598815 19:18235764-18235786 GGAGGGTGGGAGGGGAGCCCCGG - Intronic
1163745178 19:19042588-19042610 CCAGGGTGGTTGTAGGGCTCTGG + Intronic
1164536272 19:29088343-29088365 GCATGGAGGTGGGAGAGCCCAGG + Intergenic
1164656160 19:29923519-29923541 CCAGGGTGCTGGGTGAGGCCTGG + Intergenic
1164830787 19:31318953-31318975 CCAGGGTGGTAGGATTGTCTGGG - Intronic
1165073272 19:33267759-33267781 CCAGGGTGGAAGGATAGGTCCGG - Intergenic
1166258143 19:41620268-41620290 GCAGGGTGGGAGGAGAGCCTGGG + Intronic
1166365369 19:42275507-42275529 CCAGGGTGGCTGGAGAGCTGAGG + Intronic
1166410796 19:42554421-42554443 GCTGGGTGGGAGGAGAGCCTGGG + Intronic
1167579847 19:50334918-50334940 CCAGGATGGCAGCACAGCCCTGG + Intronic
1167645277 19:50702440-50702462 CCAGGGTGGAAGCAGGGCCTGGG - Intronic
1168149125 19:54435663-54435685 CCTGGGTGGGAAGAGGGCCCAGG - Exonic
1168347959 19:55660066-55660088 CCAGGGTGGGAGCAGGGCCGAGG - Intronic
1168404327 19:56102989-56103011 CCAGGGCGGGAGGGGAGGCCAGG + Intronic
1168524950 19:57081406-57081428 CCACTGTGGGAGGAGTGCCCTGG - Intergenic
925143038 2:1563206-1563228 TCAGGGTGGTAAGTGAGCACGGG - Intergenic
925701119 2:6639134-6639156 CAAGGGTGGTGAGAGAGCCTGGG + Intergenic
926107847 2:10163426-10163448 CCAGGCTGGGAGCAGAGGCCAGG + Intronic
927201994 2:20583674-20583696 ACAGGGACGGAGGAGAGCCCAGG - Intronic
927711549 2:25329174-25329196 CGAGGGAGGGAGAAGAGCCCAGG + Intronic
927982351 2:27381893-27381915 TCAGGGTGGTAGGAGAGGAATGG + Intronic
928051845 2:28006312-28006334 CCAGGATGGTAGGGGAAACCAGG - Intronic
928308039 2:30187368-30187390 CCAGGGTGGCAGTGCAGCCCCGG - Intergenic
928885992 2:36149151-36149173 GGAGGGTGGGAGGAGAGCCAGGG - Intergenic
929606857 2:43240545-43240567 CCCTGGTGGGTGGAGAGCCCTGG - Intronic
931488160 2:62714815-62714837 CCAGGGAGGTAGGAGTAACCAGG + Intronic
931920085 2:67005753-67005775 TGAGGGTGGTAGGAGGACCCAGG - Intergenic
932075508 2:68659220-68659242 ACACTGTGGTAGAAGAGCCCTGG - Intergenic
932111210 2:69002738-69002760 CTAGTGTGGGAGGAGGGCCCTGG - Intergenic
933046045 2:77538808-77538830 CCAGTGTTGGAGGAGAGACCTGG + Intronic
933297754 2:80509658-80509680 CCTGGGTGATAGAAGGGCCCTGG - Intronic
933659602 2:84916461-84916483 CCAGGGTGGCAGTGCAGCCCCGG - Intergenic
933726653 2:85430964-85430986 CGGGGGTGCTGGGAGAGCCCCGG + Intronic
933944632 2:87275386-87275408 CCAGGGTGGCAAGAGAATCCAGG + Intergenic
934567604 2:95349230-95349252 CCAGGCTGGTGGGACAGCCTGGG - Intronic
935146644 2:100399911-100399933 CCATGGTGGGTGGAGGGCCCGGG - Intronic
935176507 2:100653860-100653882 ACAGGCAGGTAGGAGGGCCCTGG - Intergenic
935689071 2:105714185-105714207 CCAGGGTGGTAGGTGGGTCTGGG - Intergenic
936009777 2:108918179-108918201 CCAGGGTGGGGCGCGAGCCCTGG + Intronic
936335580 2:111586192-111586214 CCAGGGTGGCAAGAGAATCCAGG - Intergenic
937249639 2:120515307-120515329 TCAGGGAGGAAGGAGAGTCCAGG - Intergenic
937249672 2:120515470-120515492 CCAGGGAGGAGGGAGAGTCCAGG - Intergenic
937249750 2:120515811-120515833 CCAGGGAGGAGGGAGAGTCCAGG - Intergenic
937251656 2:120527725-120527747 CCAGAGCGGGAGGAGCGCCCGGG + Intergenic
938168571 2:129055388-129055410 CCAGGGAGGAAGGAAGGCCCAGG - Intergenic
938296967 2:130184523-130184545 CCAGGGTCCTGTGAGAGCCCAGG + Intronic
939938079 2:148316171-148316193 CCAGTGTTGGAGGAGTGCCCTGG - Intronic
940636998 2:156309538-156309560 CCAGTGTTGGAGGAGGGCCCTGG - Intergenic
941377544 2:164750475-164750497 CCAGGGTGGTAGCAGGGAGCTGG - Intronic
943065383 2:183080732-183080754 CCAGGATAGTGGGAGAGTCCTGG + Intronic
945618920 2:212108901-212108923 CTATGGTGGTAGGAGAGTACAGG + Intronic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
946652581 2:221909699-221909721 CCAGTGTGGTACATGAGCCCTGG + Intergenic
946705676 2:222456517-222456539 CCGGGGAGGTAGGAGAGACGGGG - Intronic
948253992 2:236552774-236552796 CCAGGGAGGGAGGGGACCCCAGG + Intergenic
948679323 2:239621921-239621943 CCAGGGCTGCAGGAGTGCCCGGG - Intergenic
948830998 2:240598210-240598232 CCAGGTAGGCAGGACAGCCCTGG - Intronic
948866149 2:240775802-240775824 CCAGGGTGGGATCAGAGCCCTGG + Intronic
948890974 2:240906965-240906987 GCAGGGTGGAGAGAGAGCCCGGG + Intergenic
1168820366 20:768867-768889 CCAGGCTGGGAGGACAGCACAGG - Intergenic
1168932634 20:1636282-1636304 CCAGGGTGGTACTGGACCCCTGG - Exonic
1169084068 20:2816197-2816219 CCAGGCTGGCAGGGGAGCCTCGG - Intergenic
1169570299 20:6898828-6898850 TCAGGATGGAAGGAGACCCCTGG - Intergenic
1169977822 20:11350533-11350555 CCAGGGTGGTTTGGAAGCCCAGG - Intergenic
1171206186 20:23283176-23283198 GTGGGGTGGGAGGAGAGCCCAGG + Intergenic
1171365278 20:24618330-24618352 CCAGGGAGCGAGGAGATCCCGGG + Intronic
1171505306 20:25628258-25628280 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1172941398 20:38656984-38657006 CCAAGGTAGTAGTGGAGCCCAGG + Intergenic
1173768906 20:45640671-45640693 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1174406331 20:50305522-50305544 CCAGGGTGGTAGGCGGGGCCAGG + Intergenic
1174449401 20:50610120-50610142 CCGGGGTGGCAGGTGAGGCCGGG - Intronic
1176144192 20:63558281-63558303 CCAGGGTGGAAGCATCGCCCCGG + Intronic
1178346434 21:31832495-31832517 CCAGGGTGGTAAGATAGCAAGGG - Intergenic
1178462889 21:32818876-32818898 GCAGGATGGTAAGAAAGCCCTGG - Intergenic
1179096547 21:38321149-38321171 CCAGTGTTGGAGGAGAGGCCTGG - Intergenic
1180056215 21:45360398-45360420 CCAGGGAGGCAGGAGGGCCCGGG + Intergenic
1180224833 21:46386196-46386218 GCAGGGTGGGAGGAGGGCACGGG - Intronic
1180842202 22:18964695-18964717 CCATGGTGGGAGCAGAGCCCGGG - Intergenic
1180933916 22:19611611-19611633 CCTGGGTGGCTGGCGAGCCCTGG + Intergenic
1181032944 22:20157039-20157061 CCTGGGTGGAGGGAGAGACCAGG + Intergenic
1181059297 22:20274186-20274208 CCATGGTGGGAGCAGAGCCTGGG + Intronic
1181130387 22:20727909-20727931 CCAGTGTGGTGGGAGAGTGCAGG - Intronic
1181370112 22:22409135-22409157 CCACAGAGGAAGGAGAGCCCTGG + Intergenic
1182349601 22:29691937-29691959 CCAAGGTGGAAGCAGAGCCATGG + Intronic
1182402050 22:30086024-30086046 CCAGTGTTGGAGGAGGGCCCTGG + Intronic
1182866191 22:33606589-33606611 CCAGGGTGGAGAGAGAGCACGGG - Intronic
1183318392 22:37149266-37149288 CCAGGCTGGAGGCAGAGCCCTGG - Intronic
1183367866 22:37416799-37416821 GCAGGGTGGTGGGTGCGCCCCGG - Intronic
1183380699 22:37489221-37489243 CCAGGGTGGACGGTGGGCCCAGG - Intergenic
1183625187 22:38997451-38997473 AAAGGGAGGTGGGAGAGCCCAGG - Intergenic
1184090299 22:42289791-42289813 CCAGGGTGGCAGCTGTGCCCGGG - Intronic
1184616345 22:45640877-45640899 CCAGGGTGGAAGGGGAGGGCGGG - Intergenic
1184732163 22:46376972-46376994 CCAGGGTGCTTGGAGTGGCCAGG + Intronic
949845267 3:8363294-8363316 CCAGGGTGGGAAGAGAGAGCTGG - Intergenic
950333969 3:12179107-12179129 CCAGGGAGGAAGGAGAGAGCTGG - Intronic
951241250 3:20288231-20288253 CCATGGTGGAAGGAGAGGCCTGG + Intergenic
951781962 3:26373756-26373778 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
953420135 3:42747852-42747874 CCAGCGTGGCAGGAGAGCCATGG + Intronic
953667210 3:44934021-44934043 CCATGGTGTTGGGAGGGCCCCGG + Intronic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
953932501 3:47012722-47012744 CCAGACTGCTAGGAGAGTCCAGG - Intergenic
955765894 3:62343570-62343592 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
956871343 3:73421231-73421253 CTAGGGTGTTAGGAGTGTCCAGG - Intronic
961280850 3:125765299-125765321 CCAGGAAGGCAGGAGAGGCCAGG - Intergenic
961452611 3:127009195-127009217 CAGGGGTGGTAGCAGGGCCCTGG + Intronic
961589979 3:127971627-127971649 CCAGGATGGCAGGGGAGCTCAGG + Intronic
961641100 3:128365234-128365256 CCTGAGTGGATGGAGAGCCCTGG + Intronic
962328130 3:134452942-134452964 CCAGTGTTGGAGGAGAGACCTGG - Intergenic
963572682 3:147016901-147016923 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
963838707 3:150082580-150082602 ACCGGCTGCTAGGAGAGCCCAGG - Intergenic
964368676 3:155976110-155976132 CCCGGGAGGGAGGAGAACCCGGG + Intergenic
964368683 3:155976127-155976149 CCCGGGAGGGAGGAGAACCCGGG + Intergenic
964624807 3:158748812-158748834 CCAGGGAGGTTGGACAGGCCTGG - Intronic
965049538 3:163627440-163627462 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
968754845 4:2409842-2409864 ACAGGGTGGGAGGAGAGGCTGGG + Intronic
968900681 4:3430298-3430320 ATAGGGTGTTAGGACAGCCCAGG + Intronic
968952921 4:3703794-3703816 CCAGGGAGGCAGGAGAGTCCTGG - Intergenic
969016829 4:4108774-4108796 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
969496813 4:7530960-7530982 ACAGGATGGTAGGAGACCGCAGG - Intronic
969675010 4:8609837-8609859 CCAGGGTCCCAGGAGAGGCCTGG + Intronic
969714813 4:8863368-8863390 CCAGGGAGGCGGGAGAGGCCGGG - Intronic
969737133 4:8999541-8999563 CCAGGAAGGCAGGAGAGGCCAGG - Intergenic
969796325 4:9531129-9531151 CCAGGAAGGCAGGAGAGGCCAGG - Intergenic
970224995 4:13848763-13848785 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
972354474 4:38267537-38267559 CCAGGGTGGTACCTGTGCCCTGG - Intergenic
973646008 4:52952091-52952113 CCAGGTTGGTAAGAGAAGCCTGG + Intronic
977612705 4:99052642-99052664 CCAGTGTTGGAGGAGAGGCCTGG - Intronic
977814997 4:101404777-101404799 CCAGGGTGGTCTCAAAGCCCTGG - Intergenic
978557653 4:109998018-109998040 CCAGGGTGGGAGGAGGACACAGG - Intronic
979225050 4:118275350-118275372 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
979386143 4:120067413-120067435 CCAGAGGGGTAGGCGAGTCCGGG + Intergenic
980153582 4:129079087-129079109 CCAGTGTTGGAGGAGAGCCCTGG - Intronic
980158529 4:129133826-129133848 CCAGCGAGGCAGAAGAGCCCAGG - Intergenic
980595717 4:134952370-134952392 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
981316909 4:143349457-143349479 CCAGGGTGGCAGTGCAGCCCTGG + Intronic
983904401 4:173169120-173169142 CCAGGGAGGTCGGAGTGCGCGGG - Intronic
985779498 5:1862760-1862782 CCATGATGGTAGGAAAGGCCAGG - Intergenic
985946442 5:3188270-3188292 CCAGGGTGGTGGAAAGGCCCTGG + Intergenic
986402267 5:7394192-7394214 CCACGGTGGGAGGTGAGCCTTGG + Intergenic
987827106 5:23046196-23046218 CCAGGGTTGGAGGAGGGGCCTGG + Intergenic
988139195 5:27213673-27213695 CCAGTGTAGGAGGAGAGGCCTGG - Intergenic
988663865 5:33303317-33303339 AGAGGGTGGGAGGACAGCCCTGG + Intergenic
989805759 5:45601919-45601941 CCAGTGTTGTGGGAGAGACCAGG + Intronic
994174868 5:96700719-96700741 CCGGGGTGGGGGAAGAGCCCAGG + Intronic
997196761 5:131985522-131985544 CCTGGCTGGTTGGGGAGCCCAGG - Intronic
997284211 5:132666807-132666829 CCAGTGTCGCAGGAGTGCCCTGG + Intergenic
998161393 5:139814699-139814721 CCAGGGAGAAAGGAGAACCCGGG + Intronic
998172951 5:139883129-139883151 CCAGGGAGACAGGAGAGTCCTGG - Intronic
998884140 5:146676420-146676442 ACAGTGTGGAAGGAGGGCCCAGG - Intronic
999093069 5:148954717-148954739 CCAGGATGGTTGGAGATCTCTGG - Intronic
999286809 5:150399098-150399120 TCAGGGTGGGAGGACAGCTCTGG + Intronic
999288203 5:150406846-150406868 CCAGGGTGGTGGGAGGGGCAAGG - Intronic
999431829 5:151531410-151531432 CCAGGGTGGAAGGAGGGACCTGG + Intronic
1000422377 5:161053541-161053563 CCAGGGTTGGAGGAGGGGCCTGG - Intergenic
1001311316 5:170612908-170612930 CCAGGGAGAGAGGAGAGACCTGG - Intronic
1001431684 5:171667485-171667507 CCAGGGTGGTAGGGTGGGCCTGG + Intergenic
1001705015 5:173735299-173735321 CCAGGCCGGCAGGAGGGCCCTGG - Intergenic
1002397523 5:178969715-178969737 CCGAGGTGGGAGGAGAGGCCAGG - Intergenic
1002427452 5:179184726-179184748 CCAGTGGGGAAGGAGAGACCAGG - Intronic
1006013307 6:31060300-31060322 CCTGGGTGGTAGGAGAACGCGGG - Intergenic
1007044886 6:38762857-38762879 CAAGGGTGATAGCAGTGCCCTGG - Intronic
1007669359 6:43539004-43539026 CCAGGGTGGCAGTGCAGCCCTGG + Intronic
1009624872 6:66126533-66126555 CCAGGGTGGGTGGAGAGGCCAGG + Intergenic
1011862219 6:91773535-91773557 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
1012848087 6:104414782-104414804 GCAGGGTGGAAAGAGAGGCCAGG + Intergenic
1013419337 6:109951788-109951810 CCAGGGTTGGAGGAGAGGCCTGG + Intergenic
1013657613 6:112261674-112261696 CAAGGGTGCTAGGAGAGGCATGG - Intergenic
1014213931 6:118735261-118735283 CCAGGGTGGAATGTGAGCCCAGG + Intergenic
1014933470 6:127360981-127361003 ACAAGGTGGCAGGAGAGACCTGG - Intergenic
1017589965 6:155968288-155968310 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
1018289980 6:162282125-162282147 CCACGGGGGTTGGAGACCCCTGG + Intronic
1018830392 6:167438119-167438141 CAAGGGTGGGAGGAGCGCACAGG - Intergenic
1018896097 6:168018654-168018676 CCAGGGTGGTAGGAGAGCCCCGG + Intronic
1022813421 7:33891021-33891043 CCAGGGTGGAGGCAGAGCCTGGG + Intergenic
1023030233 7:36084639-36084661 CCAGGGAAGGAGGAGATCCCTGG + Exonic
1023388853 7:39687984-39688006 CCAAGGTGGGAGGATCGCCCTGG - Intronic
1023990664 7:45126429-45126451 CCTGGGTGGGAGGAGGGCCTCGG + Intergenic
1024259903 7:47566257-47566279 CCCGGCTGGTAGGTGAGCCTGGG + Intronic
1024310545 7:47965348-47965370 ACAGGGTGCTAGGACAGCGCAGG + Exonic
1024353371 7:48390602-48390624 CCAGGGTCAAAGGAGAGCACAGG - Intronic
1024559771 7:50632958-50632980 CCAGGGTGGTGGCAGAGTGCAGG + Intronic
1026736502 7:72952277-72952299 CCAGGCTGGATGGAGTGCCCTGG - Intergenic
1026772429 7:73211008-73211030 CCACGGTGGGAAGGGAGCCCTGG + Intergenic
1027107232 7:75412785-75412807 CCAGGCTGGATGGAGTGCCCTGG + Intergenic
1028201667 7:87969063-87969085 CCAGTGTTGGAGGAGAGGCCTGG - Intronic
1029075307 7:97929574-97929596 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1029459918 7:100688581-100688603 CCAGGCTGCCAGGTGAGCCCCGG - Exonic
1031874847 7:127127817-127127839 CTGGGGTGGAAGGAGAGACCAGG - Intronic
1032018309 7:128393298-128393320 CCAGGGTGGAGGGACAGCTCAGG + Intronic
1032265658 7:130368316-130368338 CCTGGGTGGAAAGTGAGCCCTGG - Intronic
1032887613 7:136158518-136158540 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
1035101613 7:156402265-156402287 CCAGGGTGTGGGGAGAGACCTGG - Intergenic
1035572629 8:683153-683175 GCAGGGTGGTTTGAGACCCCTGG + Intronic
1036258569 8:7223208-7223230 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036259623 8:7229352-7229374 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1036306994 8:7610172-7610194 CCAGGAAGGCAGGAGAGGCCAGG - Intergenic
1036308050 8:7616300-7616322 CCAGGAAGGTAGGAGAGGCCAGG - Intergenic
1036310624 8:7681804-7681826 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036311666 8:7687922-7687944 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1036357842 8:8058159-8058181 CCAGGAAGGCAGGAGAGGCCAGG - Intergenic
1036358906 8:8064301-8064323 CCAGGAAGGTAGGAAAGGCCAGG - Intergenic
1036560083 8:9894307-9894329 ACAGGGTGCTTGGAGAGCCGGGG + Intergenic
1036830518 8:12016326-12016348 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1036892052 8:12602651-12602673 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036899598 8:12660626-12660648 CCAGGAAGGTAGGAGAGGCCAGG + Intergenic
1036900667 8:12666773-12666795 CCAGGAAGGCAGGAGAGGCCAGG + Intergenic
1037913645 8:22759008-22759030 CGAGGGTGGGAGGAGGGCCATGG + Intronic
1039613047 8:38934207-38934229 CCAGGGTGGTCCCAGAGTCCTGG + Intronic
1039833603 8:41237265-41237287 CGAGGGTGGTTGCAGGGCCCAGG + Intergenic
1040081360 8:43289313-43289335 CCAGGGAGGTGGGCGAGGCCAGG + Intergenic
1040948435 8:52910360-52910382 CCAGGGTTGGAGGTGATCCCTGG + Intergenic
1041723701 8:60998983-60999005 CCAGAGTGGTTTGAGAACCCAGG + Intergenic
1042217543 8:66441327-66441349 CTGAGGTGGTAGGATAGCCCAGG - Intronic
1043735091 8:83731271-83731293 ACAGGGTGTGAGGAGAGGCCAGG + Intergenic
1045270889 8:100660667-100660689 CCAGGCTGCTGGGAGAGGCCAGG - Intronic
1045414526 8:101952786-101952808 CCAGGGTGCTAAGGGAGCACAGG + Intronic
1045476785 8:102559741-102559763 CAATGATGGCAGGAGAGCCCTGG - Intronic
1045674679 8:104593895-104593917 CCAGTGTTGGAGGAGAGGCCTGG + Intronic
1045752940 8:105508013-105508035 CCAGGCTGCTAGGAGTGCCAAGG + Intronic
1048023229 8:130559932-130559954 CCAGTGTTGAAGGAGAGGCCTGG + Intergenic
1049277050 8:141725177-141725199 CCAGGCTAGCAGGAGAGCACAGG - Intergenic
1049307136 8:141910081-141910103 CCCGGGAGGTAGGTGAGCACTGG - Intergenic
1049310432 8:141931248-141931270 CTAGGGAGGAAGGAGAGGCCTGG + Intergenic
1049466885 8:142755428-142755450 CCAGGGTGGGATGGGAGCTCAGG + Intergenic
1049614930 8:143571961-143571983 CCAAGGTGGTGGGAGGGGCCTGG - Intronic
1050317673 9:4419898-4419920 CCAATGTGGTAGGTGAGGCCTGG - Intergenic
1051317946 9:15863393-15863415 CCATGGGGGAAGGAGAGTCCAGG + Intronic
1052866454 9:33467272-33467294 CAAGGGTGGTAGTAGAGCTGGGG + Intronic
1055859485 9:80730906-80730928 CCAGGGAGGTGGGACTGCCCTGG + Intergenic
1056499650 9:87196243-87196265 CCACGGTGTTTGGAGAGCACTGG + Intergenic
1056532400 9:87498500-87498522 CCACGGTGTTAGGAGAGGCGCGG + Intronic
1056845298 9:90032353-90032375 CCAGGGTTGTGGGTGACCCCAGG - Intergenic
1058588118 9:106532157-106532179 CCAGGGAAGTAGGAGAATCCAGG + Intergenic
1058764196 9:108165459-108165481 CCAGGCTGGTAGTCGATCCCAGG + Intergenic
1059422224 9:114199428-114199450 CCAGGGAGGCAGGAAGGCCCAGG - Intronic
1059465625 9:114467137-114467159 CCCAGGTGATAGGAGACCCCTGG - Intronic
1059769844 9:117414859-117414881 CCCGGGTGGAAGCAGAGCCTCGG + Exonic
1060553428 9:124496403-124496425 CCAGGCTGGTGGGAGACCCAAGG - Intronic
1061261070 9:129481494-129481516 GCAGGTTGGAAGGAGAACCCAGG + Intergenic
1061380793 9:130255876-130255898 CCAAGGAGGTAAGAGAGCTCTGG + Intergenic
1061382123 9:130265020-130265042 CAAGGGAGGCAGCAGAGCCCTGG + Intergenic
1062069303 9:134546955-134546977 CCAGGGTGGTAAGCGGGACCTGG + Intergenic
1062277734 9:135738716-135738738 ACAGGGTGTTAGGGGAGCTCTGG - Intronic
1185641767 X:1592410-1592432 CCGGGGTGGTCGGAGGGCGCTGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189305813 X:39985822-39985844 CAAGGGTGTTAGGAAGGCCCTGG - Intergenic
1189429612 X:40935164-40935186 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1190702594 X:52999704-52999726 CCGTGGTGGAAGGGGAGCCCTGG - Intergenic
1192537075 X:71937277-71937299 CCAGGGTGGAGGGAGAACCAGGG + Intergenic
1193594097 X:83424147-83424169 CCAGTGTTGGAGGAGAGGCCTGG + Intergenic
1195129403 X:101839081-101839103 CCAGTGAGGTGGCAGAGCCCTGG - Intronic
1195176835 X:102320748-102320770 CCAGTGAGGTGGCAGAGCCCTGG + Intronic
1195182029 X:102366345-102366367 CCAGTGAGGTGGCAGAGCCCTGG - Intronic
1195202696 X:102565436-102565458 CCAGTGGGGTAGCAGAGCCCTGG + Intergenic
1195254760 X:103080866-103080888 CCAGTGAGGTAGCAGAGCCCTGG - Intronic
1195706779 X:107743054-107743076 CCAGGCTGCCAGGATAGCCCTGG + Intronic
1196936351 X:120734778-120734800 CCAGGGTGGGAACCGAGCCCAGG - Intergenic
1198158532 X:133985458-133985480 GCAGGGAGCTAGGAGAGCGCGGG + Exonic
1198619715 X:138492577-138492599 ACACTGTGGTAGGAGGGCCCTGG + Intergenic
1198795790 X:140392525-140392547 TGAGGGTGGTAGAAGAGCACAGG + Intergenic
1198873867 X:141202679-141202701 CCAGGGTTGGAGGAGGGACCTGG + Intergenic
1199303201 X:146236783-146236805 TCACGGAGGTAGAAGAGCCCAGG + Intergenic
1200138709 X:153886788-153886810 GCAGGGTAGGAGGCGAGCCCAGG + Intronic