ID: 1018896834

View in Genome Browser
Species Human (GRCh38)
Location 6:168025278-168025300
Sequence GCCTCCAACCGAGGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018896834_1018896841 21 Left 1018896834 6:168025278-168025300 CCCTGTGTCCCTCGGTTGGAGGC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1018896841 6:168025322-168025344 CCCGCTCCTGCTTCATCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018896834 Original CRISPR GCCTCCAACCGAGGGACACA GGG (reversed) Intronic
900889565 1:5439943-5439965 GCCACAAGCCAAGGGACACATGG + Intergenic
903152322 1:21419255-21419277 ACTTCCAACCCATGGACACAAGG + Intergenic
908235917 1:62147256-62147278 ACCTCTAACTGAGGGCCACAGGG - Intronic
912631076 1:111247339-111247361 GTAACCAACCCAGGGACACATGG - Intergenic
919384201 1:196898239-196898261 TCCTACAACCCAGGGAAACAGGG + Intronic
922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG + Intergenic
1066275306 10:33862905-33862927 GGCCCCAGCCGAGGGACACGTGG - Intergenic
1074386046 10:113017514-113017536 GGCTCCAGCCAAGGAACACAGGG - Intronic
1074592483 10:114826170-114826192 GGCTCCAAGTGAGGGAAACAAGG + Intronic
1075011134 10:118871124-118871146 GCCTTCCAGAGAGGGACACAGGG + Intergenic
1076107345 10:127834267-127834289 TCCTCCTGCCCAGGGACACAGGG + Intergenic
1076266069 10:129110751-129110773 ACCACCAACCGAGGGGCTCAAGG + Intergenic
1076849676 10:133086758-133086780 AACTCCAGCTGAGGGACACAGGG - Intronic
1077860087 11:6170256-6170278 GCCTCCAACCCAGGGATGCCAGG + Exonic
1079454440 11:20624608-20624630 GCCCCCATGAGAGGGACACAGGG - Intronic
1081638831 11:44739118-44739140 GCCACCAAACGAGGGATTCAAGG - Intronic
1083212731 11:61198763-61198785 GCCTCCATCCCAGGGGCACTTGG - Intergenic
1084090852 11:66878677-66878699 GCTTCCCTCTGAGGGACACAAGG - Intronic
1084350552 11:68595883-68595905 GCCTCCACCACAGGAACACATGG - Intronic
1090260068 11:125313037-125313059 GCCTTCCACCGAGGGCAACAGGG + Intronic
1104687442 12:130796899-130796921 GCCTCCCTCTGAGGGCCACATGG + Intronic
1104992808 12:132635569-132635591 GCCTCCAGCGGATGGACACCAGG - Intronic
1105019737 12:132808080-132808102 GCCTCCACCCGAGGGACCTATGG - Exonic
1107982803 13:45749465-45749487 GCCTGGAGCCGAGGGACAGAGGG - Intergenic
1113474811 13:110572680-110572702 CCCTGCAACGGAGGGACACCCGG - Intergenic
1114259458 14:21026185-21026207 GCCTTCCTCCGAGGGGCACAAGG - Intronic
1125775352 15:42207969-42207991 GCATCCAACCGAAGCCCACACGG + Intronic
1128450326 15:67802407-67802429 GACTCCAAAAGTGGGACACAGGG - Intronic
1128935014 15:71738619-71738641 GCCTCCAGCAGAGTCACACAGGG + Intronic
1134759156 16:16698240-16698262 TCTTCCAACCCAGGGGCACAGGG - Intergenic
1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG + Intergenic
1135919062 16:26631929-26631951 GGCTAGAACGGAGGGACACAGGG + Intergenic
1139381868 16:66537520-66537542 GCCTCCAAACCAGTGAGACAGGG - Intronic
1139527511 16:67525999-67526021 GCATCCCTCCGAGGGTCACAGGG - Intronic
1141635370 16:85311481-85311503 GCCTCCCACCGTGGGACATTGGG + Intergenic
1142360022 16:89621515-89621537 GCCTCCCACGGAGAGAGACAGGG + Intronic
1144962263 17:19051564-19051586 GCCTCCAGACCAGGGAAACAGGG + Intergenic
1144972898 17:19122956-19122978 GCCTCCAGACCAGGGAAACAGGG - Intergenic
1147450763 17:40502469-40502491 GTCTCCAGCCCAGGGACTCATGG + Intergenic
1151447946 17:74179460-74179482 GCCACAAGCCGAGGGACACCAGG + Intergenic
1155896208 18:31330185-31330207 GCTCCAAACTGAGGGACACAAGG + Intronic
1157725192 18:49958766-49958788 TCCTCCACCCAAGGGACTCACGG + Intronic
1160824963 19:1075142-1075164 GCTTACAACCGAGGGAGGCACGG - Intronic
1162440370 19:10688606-10688628 TCCTACAACCCAGGGTCACACGG + Exonic
1162497782 19:11033097-11033119 CCCTTCCCCCGAGGGACACATGG + Intronic
1163761354 19:19138264-19138286 GGCTCCCAGAGAGGGACACACGG + Intronic
1165312876 19:35039535-35039557 GTCTCCACCCCAGGTACACAGGG - Intronic
1166605825 19:44141797-44141819 GCCTCCCGCCGCGGGACACGAGG - Intronic
1167031980 19:46968426-46968448 GCCTCCAGCCGAGGGACAGCAGG - Intronic
1168391801 19:56015023-56015045 GTCTTCAACCCATGGACACAAGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926720718 2:15958194-15958216 GCCCTCAACCCAGGGAAACAAGG - Intergenic
933142946 2:78816375-78816397 ACCACCAGCCAAGGGACACATGG + Intergenic
937985085 2:127634787-127634809 TCCCACAACCCAGGGACACACGG - Intronic
939665729 2:144949271-144949293 GCCTGCAACTGAGTAACACATGG + Intergenic
942877209 2:180815105-180815127 GCCACAAACCAAGGAACACATGG + Intergenic
943676155 2:190718086-190718108 GCCCCCACCAGAGGGACTCAGGG - Intergenic
947640830 2:231707043-231707065 GGCTGCAACCGAGAGACAGACGG + Intronic
948670134 2:239563286-239563308 GCGCCCAACCGGGGGACACGTGG - Intergenic
1173203370 20:40970354-40970376 GCAGCCAACAGAGGGAAACAAGG + Intergenic
1178981363 21:37267653-37267675 GCCTCCAGCCGCGGGGCACGCGG - Intronic
949775810 3:7631279-7631301 GATTCCAACAGAGGGACACTTGG + Intronic
951850049 3:27129302-27129324 TCCTTCAAACTAGGGACACAGGG + Intronic
953854378 3:46489551-46489573 GCCACCAGCCCAGGGGCACAGGG - Intergenic
954686773 3:52375279-52375301 GCCTCCACCCGGGGGGCCCATGG - Exonic
960159860 3:114338769-114338791 GCCACCATCCGAGGGAGACTGGG + Exonic
960786102 3:121373904-121373926 GCATCCTACCCAGGGACTCAAGG + Intronic
967120869 3:186381731-186381753 GAATTCAACCGAGGGGCACAGGG - Intergenic
969497655 4:7535200-7535222 GCCTCCAACCTAGGGGATCATGG - Intronic
974013934 4:56631979-56632001 GCCTCCAACCAAGGGAGCCAAGG - Intergenic
984770463 4:183432788-183432810 ACCTCCAACCCTGGGCCACACGG - Intergenic
985781501 5:1874109-1874131 GCCTCCAGCATAGGGACAGATGG - Intergenic
986215613 5:5716348-5716370 GCCTACAACCCCCGGACACAAGG + Intergenic
999870405 5:155743933-155743955 GCTACCAACCAAGGGACACTTGG - Intergenic
1001639738 5:173236029-173236051 GCCTCCAAACAGGGGAAACAAGG - Intergenic
1002466166 5:179409977-179409999 GCCTCCCACCGGGACACACAGGG - Intergenic
1018896834 6:168025278-168025300 GCCTCCAACCGAGGGACACAGGG - Intronic
1025204248 7:56982617-56982639 GCCTCAAAGCGAGGAACACCTGG + Intergenic
1025667691 7:63594317-63594339 GCCTCAAAGCGAGGAACACCTGG - Intergenic
1026125725 7:67577800-67577822 GCCTACAACCCAGGGAAAGAAGG + Intergenic
1029101005 7:98129993-98130015 GACTCCAACCGCGGGCCTCAAGG + Intronic
1029178903 7:98685283-98685305 GCCTCCAACCAGGGCACACCTGG - Intergenic
1029487622 7:100852972-100852994 GGCTCCCACCGAGCGACACAAGG - Intronic
1029524669 7:101087617-101087639 GCCACCCACCAGGGGACACAGGG - Exonic
1029574479 7:101394223-101394245 GCCTCCAGCCAAGGGACAGGGGG + Intronic
1034458887 7:151187227-151187249 GCCTCGGAGCGTGGGACACAGGG - Intronic
1035269853 7:157712846-157712868 GCCACAAGCCGAGGGACACTGGG + Intronic
1036646473 8:10613709-10613731 GCCTCCAACTCTGGGACTCAGGG - Intronic
1039670138 8:39586642-39586664 GCCTCCAACCGCTGGGCTCAAGG - Intronic
1041918514 8:63159393-63159415 GAATTCAACTGAGGGACACAAGG + Intergenic
1042837681 8:73092794-73092816 GCCTGCAACCAACGGGCACAGGG - Intronic
1048557830 8:135498018-135498040 GCCACCAACCTAGGTTCACAGGG - Intronic
1049367726 8:142248816-142248838 GCCTGCAACCGAGTGATACAGGG - Intronic
1049838123 8:144753605-144753627 GGCTCCAAGCGAGGGACAGCTGG - Intronic
1051748564 9:20318338-20318360 GCCTGCAGCCAAGGGGCACATGG - Intergenic
1052857463 9:33416154-33416176 TCCTTCAACCGAGCAACACAGGG + Intergenic
1052971079 9:34377454-34377476 GCTTCCAATCGAGGGCCCCACGG + Intergenic
1061882482 9:133575160-133575182 GCCCCCAGCCGAGGGGCCCAGGG + Exonic
1190070356 X:47274257-47274279 CCCTCGAACGGAGTGACACAGGG + Intergenic
1193640568 X:84005937-84005959 GTCAGCCACCGAGGGACACAAGG + Intergenic
1196951666 X:120931238-120931260 GCCTAGAACCCTGGGACACACGG + Intronic
1196952350 X:120936099-120936121 GCCTAGAACCCTGGGACACACGG + Intronic
1196953035 X:120940960-120940982 GCCTAGAACCCTGGGACACACGG + Intronic
1196953720 X:120945820-120945842 GCCTAGAACCCTGGGACACACGG + Intronic
1196954405 X:120950681-120950703 GCCTAGAACCCTGGGACACACGG + Intronic
1196955088 X:120955541-120955563 GCCTAGAACCCTGGGACACACGG + Intronic
1196955776 X:120960424-120960446 GCCTAGAACCCTGGGACACACGG + Intronic
1196956457 X:120965285-120965307 GCCTAGAACCCTGGGACACACGG + Intronic
1196957139 X:120970145-120970167 GCCTAGAACCCTGGGACACACGG + Intronic
1196957821 X:120975005-120975027 GCCTAGAACCCTGGGACACACGG + Intronic
1196958503 X:120979865-120979887 GCCTAGAACCCTGGGACACACGG + Intronic
1196959184 X:120984725-120984747 GCCTAGAACCCTGGGACACACGG + Intronic
1198088520 X:133304346-133304368 GCGTCTAAGGGAGGGACACAGGG + Intronic