ID: 1018897055

View in Genome Browser
Species Human (GRCh38)
Location 6:168027094-168027116
Sequence GATGGGGGAGGCCCTCGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018897046_1018897055 8 Left 1018897046 6:168027063-168027085 CCACCAACACAGCAGTGGGGCAG 0: 1
1: 0
2: 2
3: 16
4: 215
Right 1018897055 6:168027094-168027116 GATGGGGGAGGCCCTCGACCTGG No data
1018897048_1018897055 5 Left 1018897048 6:168027066-168027088 CCAACACAGCAGTGGGGCAGGAG No data
Right 1018897055 6:168027094-168027116 GATGGGGGAGGCCCTCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018897055 Original CRISPR GATGGGGGAGGCCCTCGACC TGG Intronic