ID: 1018897991

View in Genome Browser
Species Human (GRCh38)
Location 6:168034599-168034621
Sequence CCTTAGGCAGGGGTGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1053
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 983}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018897977_1018897991 28 Left 1018897977 6:168034548-168034570 CCTGCCTGGCTAAGACAAAACTT 0: 1
1: 0
2: 2
3: 19
4: 172
Right 1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 65
4: 983
1018897983_1018897991 -8 Left 1018897983 6:168034584-168034606 CCGAGTTACAGGGTTCCTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 65
4: 983
1018897978_1018897991 24 Left 1018897978 6:168034552-168034574 CCTGGCTAAGACAAAACTTCTTG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 65
4: 983
1018897976_1018897991 29 Left 1018897976 6:168034547-168034569 CCCTGCCTGGCTAAGACAAAACT 0: 1
1: 0
2: 5
3: 70
4: 641
Right 1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 65
4: 983
1018897981_1018897991 -7 Left 1018897981 6:168034583-168034605 CCCGAGTTACAGGGTTCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 65
4: 983

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018897991 Original CRISPR CCTTAGGCAGGGGTGGAGGT GGG Intronic
900016155 1:151615-151637 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
900046421 1:510207-510229 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
900068622 1:751924-751946 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
900178211 1:1299945-1299967 CCTTTGGGAGGGGTGGGGCTGGG - Intronic
900548823 1:3243463-3243485 CCAGAGGCAGGGGCAGAGGTCGG - Intronic
900587438 1:3440019-3440041 CCCTGGGTAGGGGTGGGGGTGGG - Intergenic
901034551 1:6328531-6328553 AATTAGCCAGGGGTGGTGGTGGG + Intronic
901650059 1:10738074-10738096 CCCTTGGCAAGGGTGGGGGTGGG + Intronic
901756731 1:11445968-11445990 CCAAGGGCAGGAGTGGAGGTAGG - Intergenic
901802321 1:11715331-11715353 CCTGCGGCGGGGGTGTAGGTGGG + Intronic
901859102 1:12063086-12063108 CTTGGGGCAGGAGTGGAGGTGGG + Intergenic
902045096 1:13518206-13518228 CCTTGGGTAGGGTTGGAGGAGGG + Intergenic
902066382 1:13691592-13691614 TCTTAGGGAGGGGTGGAGGAGGG + Intergenic
902168913 1:14594994-14595016 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
902394823 1:16126882-16126904 CCCTGGGCAGGGGTGGGGGCGGG - Intronic
902580163 1:17403002-17403024 CCTTAGGCAGGTGGGGCGGGAGG - Intergenic
903242383 1:21991969-21991991 AATTAGGCAGGTGTGGTGGTGGG + Intronic
904209209 1:28874965-28874987 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
904269138 1:29337810-29337832 CATTAATCAGGGGTGGAAGTGGG + Intergenic
904348005 1:29886018-29886040 CCTCAGGCAGTGGGGGATGTGGG - Intergenic
904402599 1:30266713-30266735 AATTAGGCAGGTGTGGTGGTGGG - Intergenic
904544772 1:31260711-31260733 AATTAGGCAGGTGTGGTGGTGGG + Intronic
904647977 1:31982504-31982526 AATTAGGCAGGGGTGGTGGCAGG - Intergenic
904696417 1:32334298-32334320 CCTTATGCAGGGGTGGGGACAGG + Exonic
904923594 1:34028513-34028535 CCAGAGGCAGGGGAGGATGTGGG - Intronic
905300873 1:36985518-36985540 CCTGAGGCAGGTATGCAGGTGGG - Intronic
905370817 1:37481894-37481916 CCCTTGGCAAGGGTGGAGCTGGG + Intronic
905794129 1:40805988-40806010 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
905904529 1:41609101-41609123 CCTAGGGAAGAGGTGGAGGTGGG + Intronic
906063616 1:42964092-42964114 ATTTAAGCAGGGGTGGAGGGGGG - Intergenic
906173454 1:43747727-43747749 ACTTAGCCAGAGGTGGTGGTGGG - Intronic
906221142 1:44080385-44080407 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
906528573 1:46510637-46510659 CCTGAGGCCCGGGTGCAGGTAGG + Exonic
907010395 1:50958004-50958026 ACTTAGGCAGGGCTGGGTGTTGG + Intronic
907097660 1:51796386-51796408 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
907518761 1:55009663-55009685 CCAGAGGCAGGGGTGGGGGGTGG - Exonic
907608914 1:55847977-55847999 CCCTAGGCAGGGGCTGAGGCAGG + Intergenic
908450254 1:64247492-64247514 CCTTGGGCAGGGAAGGAGGGTGG + Intronic
908472027 1:64453544-64453566 CGTTAGCCAGGTGTGGTGGTGGG + Intergenic
908692857 1:66802295-66802317 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
909443216 1:75720841-75720863 CTTGAAGCAGGGGTGGAGCTGGG + Intergenic
909937144 1:81564933-81564955 TCTCAGGCAGTGCTGGAGGTTGG - Intronic
912372913 1:109187573-109187595 GCTGAGTCAGGGGTGAAGGTGGG - Intronic
912542873 1:110430322-110430344 TGTTAGGCAGGTGGGGAGGTGGG - Intergenic
912547505 1:110461420-110461442 GCTTGGGCAGGGGCTGAGGTGGG + Intergenic
912615817 1:111098565-111098587 CCTTCCCCAGTGGTGGAGGTGGG - Intergenic
913565342 1:120068519-120068541 CCTTTGGCATGGCTGGGGGTGGG - Intronic
913632789 1:120725043-120725065 CCTTTGGCATGGCTGGGGGTGGG + Intergenic
914285931 1:146227874-146227896 CCTTTGGCATGGCTGGGGGTGGG - Intronic
914546963 1:148678627-148678649 CCTTTGGCATGGCTGGGGGTGGG - Intronic
914619545 1:149391735-149391757 CCTTTGGCATGGCTGGGGGTGGG + Intergenic
914793727 1:150902256-150902278 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
915023739 1:152806527-152806549 CCCTAGGCAGGAGGGGAGGCTGG - Intronic
915033803 1:152906045-152906067 CCTTAGGCTGGGGCAGAGTTGGG + Intergenic
915335075 1:155136263-155136285 CCGAAGGGAGGGGTGGGGGTGGG - Intronic
915456796 1:156045992-156046014 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
915793570 1:158702419-158702441 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
915965840 1:160307436-160307458 GCCTTGGCAGGGGTGGTGGTTGG - Intronic
916217440 1:162409514-162409536 TTTTAGGAAGGGGAGGAGGTAGG - Intronic
916658302 1:166897561-166897583 CCTTAGGGAGGGGAGGAGTGGGG + Intergenic
916680128 1:167096107-167096129 ACTTAGCCAGGTGTGGTGGTAGG + Intronic
916686369 1:167151069-167151091 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
916714060 1:167435093-167435115 CCGGAGGAAGGGCTGGAGGTAGG - Intronic
916737330 1:167619510-167619532 AGTTAGCCAGGCGTGGAGGTGGG + Intergenic
917023122 1:170612342-170612364 AATTAGCCAGGGGTGGTGGTTGG - Intergenic
917793901 1:178518852-178518874 CCTTAAGCAGGGCAGGAGGCAGG + Intronic
918340686 1:183565823-183565845 TCCCAGGCAGGGGTGGATGTGGG + Intronic
918806126 1:189048075-189048097 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
919193090 1:194248539-194248561 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
919724978 1:200875843-200875865 AACTTGGCAGGGGTGGAGGTGGG - Intergenic
919739758 1:200974499-200974521 CGCTAGGCAGGGGAGGAGGAAGG - Intronic
919802354 1:201361470-201361492 CCCTTGGCAGGCCTGGAGGTGGG - Intronic
920032591 1:203046177-203046199 GCTGAGGCTGGGGTGGGGGTGGG + Intronic
920045377 1:203129065-203129087 CATGAGGCAGGTGTGGAAGTAGG - Exonic
920180199 1:204127750-204127772 CCTTGTGCAGGGGAGGAGGGAGG + Intergenic
920254877 1:204648062-204648084 CCTGAGTAAGTGGTGGAGGTGGG - Intronic
921179983 1:212624686-212624708 CCAGAGGCCGGGGTGGGGGTGGG - Exonic
921628025 1:217400178-217400200 ACTTAGGCAGCAGTGGAGATGGG - Intergenic
921954513 1:220967991-220968013 ACTTAGGCTGGAGTGAAGGTGGG - Intergenic
922052093 1:222001492-222001514 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
922103976 1:222497309-222497331 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
922264299 1:223969830-223969852 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
922301638 1:224306681-224306703 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
922505795 1:226124815-226124837 CTTTAGGGAGGGATGGGGGTGGG - Intergenic
922642443 1:227247050-227247072 AATTAGCCAGGGGTGGTGGTGGG + Intronic
923521275 1:234736973-234736995 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
923554135 1:234987336-234987358 CCCTAGGCAGGGGTGGATGCCGG + Intergenic
923893686 1:238244057-238244079 ACTTAGGCGGGCGTGGTGGTGGG + Intergenic
924162882 1:241252190-241252212 CATTAGCCAGGAGTGGTGGTGGG - Intronic
924221451 1:241879856-241879878 TCTTAGGCAGGCATGGTGGTGGG + Intronic
924346147 1:243074824-243074846 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
924482630 1:244451300-244451322 ACTGAGGCCGGGGTGGAGGTGGG - Intronic
1062832893 10:617660-617682 CCCCAAGCAGGGGTGGGGGTGGG - Intronic
1063075895 10:2716184-2716206 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1063450902 10:6149436-6149458 AATTAGCCAGGGGTGGGGGTGGG + Intronic
1063471973 10:6295368-6295390 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
1063622664 10:7663667-7663689 ACATAGGCAGGGGTGGATCTAGG - Intronic
1064002423 10:11674620-11674642 CCTTAGGCAGGGGAGGAGCCTGG + Intergenic
1064102313 10:12474338-12474360 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1064128121 10:12682069-12682091 CATTAGGCAGGCGTGGTGTTGGG + Intronic
1064504690 10:16015784-16015806 GTTGAGGCAGGGGTGGAGGTGGG + Intergenic
1064932300 10:20641135-20641157 CCAAAGGCAGGAGTGGAGGTGGG - Intergenic
1064999184 10:21321508-21321530 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1065915399 10:30350695-30350717 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1065966780 10:30777128-30777150 CCTAGGGCAGTGGTGGAGATGGG - Intergenic
1066071256 10:31816000-31816022 ACTTAGGCAGGTGTGGTGGTGGG + Intronic
1066090321 10:32012324-32012346 CCTTAGGCGGGCGTGGTAGTGGG + Intronic
1066497324 10:35954978-35955000 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1066730199 10:38430002-38430024 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1066730549 10:38433037-38433059 CCTAAGGCTGGGGCGAAGGTAGG - Intergenic
1067373901 10:45709904-45709926 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
1067384739 10:45808353-45808375 CATTAGCCAGGCGTGGTGGTAGG + Intergenic
1067771461 10:49129665-49129687 CCTTGGGGAAGGGTGCAGGTGGG - Intergenic
1067974557 10:51009405-51009427 CCTTAGATTGAGGTGGAGGTGGG - Intronic
1068139835 10:52991911-52991933 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1068810961 10:61255907-61255929 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1068906886 10:62336659-62336681 CCTTATGCAGGGGAGGAAGCTGG + Intergenic
1069043949 10:63723009-63723031 AATTAGCCAGGTGTGGAGGTAGG + Intergenic
1069535707 10:69251241-69251263 AATTAGCCAGGCGTGGAGGTAGG - Intronic
1069542021 10:69302096-69302118 AATTAGCCAGGCGTGGAGGTAGG + Intronic
1069819804 10:71220390-71220412 CATTTGGCAGGGGTAGGGGTGGG + Intronic
1070383854 10:75906062-75906084 TCTGTGGCAGGGGTGGAGCTGGG - Intronic
1070751995 10:78969345-78969367 CCTGAGCTAGGCGTGGAGGTAGG - Intergenic
1070993319 10:80752127-80752149 CCTTAGTCACTGCTGGAGGTGGG + Intergenic
1071124829 10:82321288-82321310 CCTGTGGCAGGGGTGGGGGTGGG + Intronic
1071156238 10:82692612-82692634 CCTTATGCAGGGAAGGAGCTCGG - Intronic
1071933689 10:90502124-90502146 CATTAGGCAGGGGAAGAGGTGGG - Intergenic
1072409550 10:95187418-95187440 CCATGAGCAAGGGTGGAGGTGGG - Intergenic
1072469675 10:95700939-95700961 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1072916221 10:99538834-99538856 CCTTCGGCTGGGTTGGAGATGGG - Intergenic
1072997938 10:100263028-100263050 CCATAGGAAGGGGGTGAGGTGGG - Intronic
1073172298 10:101520807-101520829 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1073329010 10:102658786-102658808 GCCTTGGGAGGGGTGGAGGTGGG + Intergenic
1073470507 10:103719226-103719248 ACTCTGGCTGGGGTGGAGGTGGG + Intronic
1073513990 10:104061147-104061169 CCCTAGGCAGGTATGGAGGGTGG + Intronic
1073595896 10:104799822-104799844 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1073890851 10:108098786-108098808 GGTTAGGCAGGAGTGGAGGATGG + Intergenic
1074551122 10:114443459-114443481 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1075366552 10:121895463-121895485 AATTAGGCAGGTGTGGTGGTGGG + Intronic
1075875231 10:125800443-125800465 CCTTACGCAGGGGAGGAGCCTGG + Intronic
1076024602 10:127101107-127101129 CCCAAGGCAGGGGCAGAGGTTGG + Intronic
1076703041 10:132284164-132284186 CCTCAGGCACGGGTGGATGCGGG - Intronic
1076882331 10:133245691-133245713 CCCTAGGGAACGGTGGAGGTCGG - Intergenic
1076889101 10:133275312-133275334 CCTCAGGCAGTGCTGGAGGGAGG + Intronic
1076972747 11:146685-146707 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1077048346 11:555774-555796 CTTTGCGCAGGGGTCGAGGTGGG + Exonic
1077125853 11:936048-936070 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1077151944 11:1076632-1076654 CCTCAGGCATGGGTGCAGGCGGG + Intergenic
1077312278 11:1894380-1894402 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1077610123 11:3638907-3638929 CCTTCAGCAGGGGTGCAGCTAGG - Intronic
1077813635 11:5664050-5664072 ATTTAGCCAGGGGTGGTGGTGGG + Exonic
1077920737 11:6640161-6640183 CCTCAGGCAGGGGCTCAGGTCGG + Exonic
1078052628 11:7980269-7980291 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1078171624 11:8932917-8932939 CCTGAGGCTGAGGTGGAGGCTGG - Exonic
1078215237 11:9306355-9306377 CCTTTGGCCTGGGAGGAGGTTGG - Intronic
1078962459 11:16293620-16293642 CCTTAAGTAGGGGTGGGAGTGGG + Intronic
1079341252 11:19613396-19613418 CCTGATGCAGTGGTGGTGGTAGG - Intronic
1080694863 11:34594694-34594716 GCTGAGGCAGGGGTAGGGGTAGG - Intergenic
1081536042 11:43996959-43996981 AATTAGCCAGGAGTGGAGGTGGG - Intergenic
1081571905 11:44296858-44296880 AATTAGGCAGGTGTGGTGGTGGG + Intronic
1081919978 11:46765751-46765773 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1083197907 11:61102137-61102159 CCTGAGGCAGGGGTCTGGGTGGG - Intergenic
1083348260 11:62009308-62009330 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1084318665 11:68360846-68360868 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1084572539 11:69968256-69968278 CCTGAGCCAGGGGTGGTGGTGGG + Intergenic
1084873968 11:72117125-72117147 CCTTAGGCAGGGGCTGTGGTTGG + Intronic
1085115820 11:73930596-73930618 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1085190895 11:74621416-74621438 CCATAGACAGGGGTGGTGGTGGG - Intronic
1085347420 11:75777139-75777161 CTTGAGGCAGGGGTGGGGGTGGG - Intronic
1085568566 11:77538953-77538975 CATTAGCCAGGGGTGGTGGTGGG + Intronic
1087088875 11:94247651-94247673 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1087212560 11:95458650-95458672 CCTGAGACACGTGTGGAGGTGGG - Intergenic
1087322721 11:96683148-96683170 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1088308509 11:108435563-108435585 CCTTGCTCAGGGGTGGAGGAAGG - Intronic
1088848689 11:113688483-113688505 GGTTGGGCAGGGGTGGGGGTTGG - Intronic
1089012126 11:115139944-115139966 ACTGGGGCTGGGGTGGAGGTGGG + Intergenic
1089300794 11:117497633-117497655 CCTCCAGCAGCGGTGGAGGTGGG + Intronic
1089319219 11:117613676-117613698 CGTTAGGCAGGCGGGGAGGCAGG + Intronic
1089458882 11:118641291-118641313 CCTTGGGCCTGGGTGGAGCTAGG + Intronic
1089648235 11:119894404-119894426 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1089788256 11:120923559-120923581 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1089963693 11:122637915-122637937 CCCAAGGCAGGAGTGGAGGAGGG - Intergenic
1090640678 11:128726541-128726563 GCTTAGGCGGGGGTGGGGGTAGG - Intronic
1090807410 11:130211029-130211051 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1090860382 11:130647668-130647690 CCACAGGCAGGTGAGGAGGTGGG - Intergenic
1091029230 11:132169482-132169504 ACTTAGCCAGGCGTGGAGGTGGG - Intronic
1091601593 12:1921260-1921282 CCTTGGAAAGGGGTGGATGTAGG - Intergenic
1092003665 12:5051101-5051123 CCTCAGGAAGGAGTGTAGGTAGG - Intergenic
1092166165 12:6343617-6343639 CCTTGGGCGGGGCTGGATGTAGG - Intergenic
1092350014 12:7748673-7748695 CCTGAGGCAGGGGCAGAGGGAGG - Intronic
1092378702 12:7977300-7977322 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1092659341 12:10722461-10722483 CCTTGGGTAGGGATGGATGTAGG - Intronic
1092736271 12:11585821-11585843 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1093928386 12:24931049-24931071 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1094571926 12:31648708-31648730 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1094738229 12:33259488-33259510 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1095399685 12:41800239-41800261 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1095468922 12:42516278-42516300 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1095531293 12:43189827-43189849 ACTTAGGAAAGGGTGGAGATTGG + Intergenic
1095673822 12:44892647-44892669 CATTAGCCAGGAGTGGTGGTGGG + Intronic
1095947595 12:47762409-47762431 ACTTAGGCAGTAGTGGAGTTTGG - Intronic
1096026248 12:48365535-48365557 CATTAGCCAGGCGTGGTGGTCGG - Intergenic
1096032561 12:48433594-48433616 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1096359447 12:50971025-50971047 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1096364199 12:51014702-51014724 CATTAGCCAGGCGTGGTGGTAGG + Intronic
1096824910 12:54267993-54268015 CATTAGTCAGGCGTGGTGGTGGG + Intronic
1096878904 12:54651510-54651532 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1097601634 12:61699692-61699714 CCTTAGGCAGGGGAGGAGGCTGG + Intergenic
1097620746 12:61936417-61936439 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
1097814072 12:64052404-64052426 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1097936445 12:65257394-65257416 CATTAGGCAGGGGTGGTGGCAGG - Intergenic
1098367431 12:69719554-69719576 TCTTTGGGAGGGGTGGAAGTGGG + Intergenic
1098763749 12:74458417-74458439 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1098886661 12:75967664-75967686 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1099683805 12:85860634-85860656 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1099840293 12:87956090-87956112 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1099951069 12:89304304-89304326 AGTTAGTAAGGGGTGGAGGTGGG - Intergenic
1100236882 12:92670461-92670483 ACATAGGAAGGGTTGGAGGTGGG - Intergenic
1100329920 12:93572619-93572641 CCTGCGGCTGGGGTGGGGGTGGG - Intronic
1100388257 12:94123617-94123639 AATTAGCCAGGTGTGGAGGTAGG - Intergenic
1100656106 12:96647322-96647344 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1100882112 12:99030445-99030467 CATTAGACGGGGGTGGGGGTTGG - Intronic
1101652188 12:106687403-106687425 AATTAGCCAGGTGTGGAGGTGGG + Intronic
1102182476 12:110922913-110922935 CCTCAGACAGGGGCGCAGGTGGG + Intergenic
1102482950 12:113236460-113236482 ACTTAGGAAGAGGTGGAGTTTGG + Intronic
1102585556 12:113920352-113920374 CGTGAGCCAGGGGTGGTGGTAGG - Intronic
1102957465 12:117068379-117068401 AATTAGCCAGGTGTGGAGGTGGG + Intronic
1103058868 12:117842909-117842931 ACTAAGGCAGGGGTGGAGGGAGG - Intronic
1103301092 12:119927147-119927169 AATTAGCCAGGGGTGGGGGTGGG + Intergenic
1103417527 12:120753469-120753491 CATTAGCCAGGAGTGGTGGTGGG - Intergenic
1103434336 12:120913381-120913403 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1103435768 12:120924331-120924353 AATTAGGCGGGGGTGGTGGTGGG - Intergenic
1103616876 12:122159338-122159360 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
1103680740 12:122691595-122691617 CCTTGGACAGGGGTGGTGTTTGG - Intergenic
1104237775 12:126955936-126955958 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1104359311 12:128117084-128117106 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1104460557 12:128952408-128952430 CCCTGGGCAGGGGTGTAGGGTGG + Intronic
1104480101 12:129100187-129100209 AATTAGCCAGGGGTGGTGGTAGG - Intronic
1104647406 12:130506984-130507006 ACTGAGGCTGTGGTGGAGGTGGG - Intronic
1104699231 12:130889063-130889085 CCTGGGGATGGGGTGGAGGTAGG - Intergenic
1104980037 12:132569681-132569703 CCGTGGCCAGGGGTGGGGGTGGG - Intronic
1104999715 12:132682143-132682165 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1105266674 13:18824951-18824973 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1105390994 13:19978023-19978045 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1105507942 13:21026272-21026294 ACTTAGGGTGGGGTGGAGGGAGG - Intronic
1105592628 13:21808749-21808771 CCATTGGCAGGGGTGGAATTGGG + Intergenic
1105722892 13:23134610-23134632 CCTGGGGAAGGGGTGGGGGTGGG - Intergenic
1106272651 13:28169376-28169398 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1106671900 13:31915035-31915057 CGATAGGCAGAGGTGGAGGTGGG + Intergenic
1106709605 13:32315786-32315808 TCTCAGGCATGGGTGGGGGTTGG - Intronic
1106736375 13:32591815-32591837 TCTTAGGTAAGGGTGAAGGTAGG - Intronic
1106758464 13:32845110-32845132 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1107125070 13:36837865-36837887 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1107281771 13:38744638-38744660 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1107313104 13:39101347-39101369 GTTTAGGCTGGGGTGGGGGTCGG + Intergenic
1107369489 13:39728811-39728833 AATTAGCCAGGTGTGGAGGTGGG - Intronic
1107464020 13:40632487-40632509 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1107484679 13:40814153-40814175 CCTCAGGCAGAGGCTGAGGTAGG - Intergenic
1107538038 13:41355576-41355598 ACTTAGGCAGGAGTGGTGGCAGG - Intronic
1107929372 13:45294407-45294429 CATTAGCCAGGTGTGGCGGTGGG - Intergenic
1107940782 13:45378708-45378730 CCTAAGGCAGGGGGGGAAGAGGG + Intergenic
1107940909 13:45379372-45379394 CCTAAGGCAGGGGGGGAAGAGGG + Intergenic
1107941977 13:45383272-45383294 CCTAAGGCAGGGGGGGAAGAGGG + Intergenic
1108053649 13:46466550-46466572 CCTAAGGCAGGGGGGGAAGAGGG - Intergenic
1108487227 13:50939206-50939228 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1109537351 13:63738386-63738408 CCTAAGGCAGGGGGGGAAGAGGG + Intergenic
1109537793 13:63740280-63740302 CCTAAGGCAGGGGAGGAAGAGGG + Intergenic
1109546890 13:63843189-63843211 CCTAAGGCAGGGGGGGAAGAGGG - Intergenic
1109924023 13:69110133-69110155 CCTTATGCAGGGGAGGAGCCAGG + Intergenic
1110674912 13:78230659-78230681 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1111237345 13:85426882-85426904 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1111747515 13:92289285-92289307 CTGTTGGCAGGGGTGGGGGTTGG - Intronic
1111950384 13:94704859-94704881 CCGGAGGCAAGGGTGGCGGTGGG + Intergenic
1112504770 13:99969190-99969212 CCAGAGGCAGGGCTTGAGGTGGG + Intronic
1112515646 13:100050648-100050670 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1113073383 13:106444498-106444520 CATTTGGCGGGGGTGGGGGTGGG - Intergenic
1113116558 13:106880210-106880232 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1113125709 13:106976463-106976485 CTTTAGCCAGGCGTGGTGGTCGG - Intergenic
1113155053 13:107310824-107310846 TCTTAGCCAGGTGTGGTGGTGGG - Intronic
1113212490 13:108000252-108000274 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
1113819651 13:113204097-113204119 CCATAAGCAGGGGTGGCTGTGGG - Intronic
1113844626 13:113379543-113379565 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1114180141 14:20359850-20359872 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1114341994 14:21754621-21754643 CCTGGGGAAGGGGTGGATGTGGG + Intergenic
1114756829 14:25269292-25269314 CATTAGGTGGGGGTAGAGGTAGG + Intergenic
1115407434 14:33033328-33033350 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1115645791 14:35367783-35367805 TCTTTGGCTGGGGTGGGGGTGGG + Intergenic
1115662458 14:35510802-35510824 CCATGGACAGGGGTGGGGGTGGG + Intergenic
1115819592 14:37199671-37199693 ACTTAGCCAGGCGTGGTGGTAGG - Intronic
1116600148 14:46910986-46911008 CCTATTGAAGGGGTGGAGGTTGG + Intronic
1117399885 14:55349343-55349365 CCTTGGCCAGGGGTAGAGATGGG - Intronic
1117736966 14:58777528-58777550 CCCTGGGCAGGGGTGGAAGCGGG - Intergenic
1117868021 14:60169631-60169653 CCTAGGGAAGGGGTGGAGGATGG - Intronic
1118106317 14:62663920-62663942 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1118527312 14:66661084-66661106 ACTTAGGCAGGGCGGGAGCTTGG + Intronic
1118579907 14:67285513-67285535 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1118617643 14:67585758-67585780 GCTTGGGCAGGAGTGGGGGTAGG - Intronic
1118644940 14:67829389-67829411 ACTTAGCCAGGCGTGGAGGTGGG - Intronic
1119529198 14:75347811-75347833 GTTTAGGCAGGCGTGGAGGTGGG + Intergenic
1119677778 14:76568946-76568968 CCTTAGGCAGGGGCTGGGGTAGG - Intergenic
1119997943 14:79273483-79273505 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1120663426 14:87277940-87277962 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1120721267 14:87891928-87891950 CATTAGGAAATGGTGGAGGTTGG + Intronic
1120845273 14:89119666-89119688 CCTTGGGTAGGGGTGAAGGTGGG + Intergenic
1120937295 14:89909853-89909875 CCTTAGCCAGGGAAGGAGGGAGG - Intronic
1121067559 14:90982962-90982984 AATTAGGCAGGGGTCGTGGTGGG + Intronic
1121332792 14:93059183-93059205 CATGAGGCAGGGGTGGAGGGGGG + Intronic
1121332851 14:93059351-93059373 CACAAGGCAGGGGTGGAGGGGGG + Intronic
1122083737 14:99285197-99285219 CCTTAGCTAGGTGTGGTGGTGGG - Intergenic
1122538107 14:102480371-102480393 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1122705207 14:103616557-103616579 AATTAGGCAGGCGTGGTGGTGGG + Intronic
1122810317 14:104284507-104284529 CCTGAGGGAGGGGTGCAGGCAGG + Intergenic
1123093183 14:105751199-105751221 CCTGAGGAAGGGGTGGGGGCAGG - Intergenic
1202871478 14_GL000225v1_random:168962-168984 ATTTAGGCAGGTGTGGTGGTGGG - Intergenic
1123756020 15:23398358-23398380 ATTTAGCCAGGGGTGGTGGTGGG - Intergenic
1123900687 15:24873594-24873616 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1124184649 15:27513299-27513321 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1124335406 15:28852264-28852286 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1124462682 15:29907258-29907280 ACTTAGCCAGGGGTGGTGGCGGG + Intronic
1124632889 15:31347350-31347372 CCTGAGGCAGGGCTGGGGATGGG + Intronic
1124848162 15:33311312-33311334 CCTGGGGCAGGGGTGGCGGTAGG - Intronic
1125012021 15:34888147-34888169 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1125027235 15:35042853-35042875 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1125178800 15:36857388-36857410 TCTGTGGCTGGGGTGGAGGTTGG + Intergenic
1125749466 15:42018901-42018923 CTTTTGGCAGGGGTGAGGGTGGG + Intronic
1125954245 15:43778110-43778132 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1126161136 15:45614634-45614656 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1126524414 15:49635181-49635203 ATTTAGGCAGGTGTGGTGGTGGG - Intronic
1126708361 15:51428833-51428855 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1127603397 15:60561809-60561831 CCCCATGCAGGGGTGGTGGTGGG + Intronic
1127813745 15:62588027-62588049 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1128083756 15:64872213-64872235 GCCTAGGCAGGGGTAGAGGAAGG - Intronic
1128143451 15:65318274-65318296 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1128480502 15:68033591-68033613 CCTTAGGAAGGGGTGGGTGAAGG - Intergenic
1128700610 15:69801430-69801452 AGTTAGGGAGGGGTGGAGGATGG - Intergenic
1128702438 15:69814077-69814099 CCTTAGGCAGGTGTGGGGAAAGG + Intergenic
1128742243 15:70091968-70091990 CTTTAAGCTGGGGTGGGGGTGGG - Intronic
1128767243 15:70258757-70258779 GCTCAGGCTGGGGTTGAGGTCGG - Intergenic
1129107166 15:73318456-73318478 CCTTAGCAAGGGCTGGCGGTAGG - Intergenic
1129454148 15:75667559-75667581 CCTAAGGCAGGGTGGGAGGTGGG - Intergenic
1129600959 15:76997876-76997898 CCTTGGGCTGGGGTGGGGGAAGG - Intronic
1129801727 15:78420011-78420033 ACTTTGGAAGGGGGGGAGGTGGG - Intergenic
1130610450 15:85355984-85356006 ACTTAGGCAGGCGTGGTGGTGGG + Intergenic
1130991148 15:88876895-88876917 CCTGAGGCGGGGGTGGGAGTGGG + Intergenic
1131648399 15:94371835-94371857 CCTTAGCCAGGTGTGGTGGCAGG - Intronic
1131812510 15:96187094-96187116 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1131819239 15:96255341-96255363 AATTAGGCAGGTGTGGTGGTGGG + Intergenic
1132784536 16:1648454-1648476 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1132820176 16:1862767-1862789 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1133008366 16:2896943-2896965 TCAGAGGCAGGGTTGGAGGTCGG - Intronic
1133120919 16:3606963-3606985 CGTTAGGTAGTGGTGGTGGTTGG + Intronic
1133124117 16:3633955-3633977 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1133289497 16:4709860-4709882 CATTAGCCAGGTGTGGTGGTAGG + Intronic
1133402597 16:5499719-5499741 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1133625117 16:7563883-7563905 CAGTGGGCAGGGTTGGAGGTTGG - Intronic
1133636157 16:7667820-7667842 AATTAGCCAGGGGTGGTGGTAGG - Intronic
1133838536 16:9387653-9387675 CCATATACAGGGGTGGAGGGTGG + Intergenic
1133868904 16:9669691-9669713 CCTAGGGCTGGGGTGTAGGTTGG + Intronic
1133929825 16:10223041-10223063 CCTATGCCAGAGGTGGAGGTTGG + Intergenic
1134036401 16:11034572-11034594 CCGTGGACAGGGGTGGAGGGCGG - Intronic
1134092926 16:11401220-11401242 CCTTGGCCGGGGCTGGAGGTGGG - Intronic
1134411850 16:14009913-14009935 CCTGGGGCAGGGGTGGAAGGGGG - Intergenic
1134417963 16:14060995-14061017 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1134460311 16:14424356-14424378 ATTTAGCCAGGGGTGGTGGTGGG + Intergenic
1134651819 16:15915349-15915371 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1134796657 16:17044949-17044971 GCTTGGGGTGGGGTGGAGGTGGG - Intergenic
1135053195 16:19209014-19209036 AATTAGGCAGGTGTGGTGGTGGG - Intronic
1135640509 16:24115872-24115894 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1136128060 16:28199713-28199735 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1136236974 16:28920532-28920554 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1136424036 16:30156941-30156963 AATTAGCCAGGTGTGGAGGTGGG + Intergenic
1136499761 16:30664452-30664474 CCTGCAGCAGGGGTGGGGGTGGG - Exonic
1137038045 16:35583709-35583731 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1137589949 16:49687298-49687320 ATTTAGGAAGGGGTGGAAGTGGG + Intronic
1137615422 16:49843651-49843673 CCTTGGGGAGGGGAGGGGGTTGG - Intronic
1137631481 16:49949138-49949160 AATTAGGCAGGCGTGGTGGTGGG + Intergenic
1137744930 16:50813415-50813437 CCTTAGGGAAGGGAGAAGGTTGG + Intergenic
1138235592 16:55379849-55379871 CCTGAGGCAGGGATAGGGGTGGG - Intergenic
1138524480 16:57594463-57594485 ACTTAGGAGGGGGTGGAGGATGG - Intergenic
1139138693 16:64234652-64234674 ACTTAAGCAGAGGTGGTGGTTGG - Intergenic
1139349191 16:66324804-66324826 CTTTAGGAAGAGGTGGAGGTGGG + Intergenic
1139366055 16:66434227-66434249 CCTTTGCCAGGGGTCGGGGTCGG - Intronic
1139367104 16:66440276-66440298 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
1139372867 16:66479473-66479495 CATGAGGCAGGGGTGGAGAGGGG + Intronic
1139765987 16:69230508-69230530 ACTTAGCCAGGCGTGGTGGTAGG - Intronic
1139784441 16:69380507-69380529 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1140086375 16:71800650-71800672 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1140409046 16:74730299-74730321 CCTGTGGCAGGGGTGGGGGTTGG + Intronic
1140657670 16:77157061-77157083 ACTTAGCCAGGCGTGGTGGTAGG + Intergenic
1141252848 16:82374562-82374584 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1141289742 16:82706653-82706675 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1141724156 16:85775292-85775314 AATTAGGCAGGCGTGGTGGTGGG + Intronic
1141925874 16:87169083-87169105 TCTTAGCCAGGCGTGGTGGTGGG - Intronic
1142222117 16:88860674-88860696 CCCCAGGAAGGGGTGGAGGAGGG - Intronic
1142233118 16:88909057-88909079 CCCCAGGCAGGGGAGGAGGAGGG + Intronic
1142234384 16:88915003-88915025 CCGGGGGCAGGGGTGGAGGGAGG + Intronic
1142447502 16:90150842-90150864 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1142459991 17:84490-84512 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1142786905 17:2231546-2231568 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1142937079 17:3343793-3343815 CGTCAGGGAGGGGTGGAGGCTGG - Intergenic
1143023754 17:3929468-3929490 CCTTAGGCCGGGGTGCAGGGAGG + Intronic
1143586431 17:7852932-7852954 CCTGAGGCAGGGCTGGAGCAAGG - Intronic
1143587108 17:7855800-7855822 GCTCAGGCAGGGGTGGGGGCAGG - Exonic
1143643743 17:8215925-8215947 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1144409408 17:14985894-14985916 CCTCAGCTGGGGGTGGAGGTGGG + Intergenic
1144472925 17:15560702-15560724 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1144614989 17:16761187-16761209 ATTTAGCCAGGGGTGGTGGTGGG + Intronic
1144730506 17:17523297-17523319 GCTGGGGCTGGGGTGGAGGTAGG - Intronic
1144897716 17:18554484-18554506 ATTTAGCCAGGGGTGGTGGTGGG - Intergenic
1145101979 17:20085083-20085105 CCTTGGGCAGGCCTGGAGGCTGG + Intronic
1145134656 17:20391234-20391256 ATTTAGCCAGGGGTGGTGGTGGG + Intergenic
1145789048 17:27613494-27613516 CCTTATGCAGGGGAGGAGCCTGG - Intronic
1145872780 17:28289361-28289383 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1146036402 17:29410782-29410804 CGTTAGCCAGGCGTGGTGGTGGG - Intronic
1146230085 17:31099706-31099728 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1146335552 17:31967048-31967070 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1146785955 17:35721505-35721527 TCAGAGGCTGGGGTGGAGGTAGG + Intronic
1146937269 17:36819887-36819909 CCACAGCAAGGGGTGGAGGTGGG - Intergenic
1147176865 17:38661237-38661259 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1147223617 17:38956437-38956459 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
1147318278 17:39631505-39631527 CCCCAGGCAGGAGTTGAGGTGGG - Intronic
1147996229 17:44361916-44361938 CCTAAGCCCGGGATGGAGGTGGG - Intronic
1148018512 17:44538933-44538955 CCTGAGGCGGGCGTGGGGGTGGG - Intergenic
1148201912 17:45755042-45755064 CCTGAGGAAGTGGCGGAGGTGGG - Intergenic
1148373708 17:47122820-47122842 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1149028900 17:52062214-52062236 CCTTAGCCAGGGATGGTGGTGGG - Intronic
1149034058 17:52115117-52115139 CCTTATGCAGGGGAGGAGCCTGG + Intronic
1149140410 17:53426619-53426641 CATGTGGGAGGGGTGGAGGTGGG - Intergenic
1150001656 17:61444194-61444216 CCGGAGGCGGGGGTGGTGGTCGG + Intergenic
1150007288 17:61477570-61477592 CCTTAGGCAGGTCTGAAGGCAGG + Intronic
1150287769 17:63963624-63963646 ACTTAGGTAGGGGTGGAGCCTGG - Intronic
1150389833 17:64783842-64783864 CCCCAGGGAGGGGTGGGGGTGGG + Intergenic
1150604619 17:66680320-66680342 TGTCAGGCAGGGGTGGAGGTGGG + Intronic
1151050173 17:70969491-70969513 CCTTAGGGTGGGGCGGATGTAGG - Intergenic
1151171827 17:72253116-72253138 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1151540569 17:74762704-74762726 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1151734934 17:75933417-75933439 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1151766124 17:76134156-76134178 GCTTAGCCAGGCGTGGTGGTGGG + Intergenic
1151963920 17:77421440-77421462 CTTTTGGCTGCGGTGGAGGTGGG + Intronic
1152040546 17:77899944-77899966 CCTCAGGCAGGGCTGGAGGGTGG - Intergenic
1152270630 17:79322666-79322688 TCCTAGGCAGGGGTTGAGGACGG + Intronic
1152739091 17:82011285-82011307 GCTTAGGCTGGGGCGGGGGTGGG + Intronic
1153137672 18:1935143-1935165 ACTTAGCCAGGGGTGGTGGTGGG + Intergenic
1153262479 18:3237972-3237994 ACTGGGGCAGGGGTGGCGGTCGG + Intergenic
1153471781 18:5454318-5454340 CCTTAGAAAGGGCTGGAGCTGGG + Intronic
1153637207 18:7122877-7122899 CTTTAGGCAGGGGTGAGGGCTGG + Intergenic
1153704698 18:7733770-7733792 CCTTATGCAGGGGAGGAGCCTGG - Intronic
1154115762 18:11611885-11611907 AATTAGGCAGGTGTGGTGGTGGG + Intergenic
1154387126 18:13904230-13904252 ACTTAGGCAGGCGAGGTGGTGGG + Intronic
1154421740 18:14236520-14236542 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1155075616 18:22351631-22351653 ATTTAGCCAGGGGTGGTGGTGGG - Intergenic
1155170736 18:23265267-23265289 CCCTTGGCTGGGGTGGAGGCTGG - Intronic
1155295607 18:24381810-24381832 AATTAGGCAGGCGTGGTGGTGGG + Intronic
1156458297 18:37307002-37307024 CTTTAGGCATGGGGGCAGGTGGG + Intronic
1156574503 18:38298962-38298984 ACTGTGGCAGGGGTGGGGGTTGG + Intergenic
1157235541 18:45961707-45961729 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1157387068 18:47266319-47266341 CCAGAGGCCGGGGTGGGGGTGGG + Intergenic
1157478879 18:48040186-48040208 CATTAGGGAAGGGTGGCGGTGGG + Exonic
1158655391 18:59326165-59326187 TCTGAGGCAGGGTTGTAGGTTGG - Intergenic
1158842201 18:61399640-61399662 TTTTAGGCAGGGGTGGAGAGAGG - Intronic
1160510441 18:79450643-79450665 GCTTGGTCAGGGGTGGAGGGTGG + Intronic
1160532226 18:79572142-79572164 CCTTAGCCAGGGCTGCAGGGAGG + Intergenic
1160649706 19:216989-217011 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1161022641 19:2017565-2017587 CCTTAGCCAGGCGTGGTGGCGGG - Intronic
1161074558 19:2279012-2279034 TCTTGGGCAGGGGTGGGGGCAGG + Exonic
1161103953 19:2434189-2434211 TGCTGGGCAGGGGTGGAGGTGGG - Intronic
1161208893 19:3056237-3056259 CCCAAGGCGGGGCTGGAGGTGGG + Intronic
1161253795 19:3295212-3295234 CCTGGGGCAGGGGCGGGGGTGGG + Intronic
1161378300 19:3951100-3951122 CCTTAGGCAGGGCTGGGCCTGGG + Intergenic
1161396408 19:4047130-4047152 CCGCAGGCAGGGTTGGAGGCGGG + Exonic
1161400131 19:4063665-4063687 CTTTAAGCAGGGCCGGAGGTTGG - Intronic
1161777294 19:6270493-6270515 CCTGAGGGAGGGGTGGAGCCTGG + Intronic
1162085359 19:8245686-8245708 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1162403462 19:10460027-10460049 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1162406654 19:10478974-10478996 GCATAGGCAGGGAAGGAGGTAGG + Intergenic
1162459851 19:10808219-10808241 CATTGGGCAGGGGTGGGGGCGGG + Intronic
1162478187 19:10913387-10913409 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1162529030 19:11224913-11224935 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1162532079 19:11241865-11241887 CATTGGGGAGGGGTGGAGGAAGG + Exonic
1163050720 19:14681584-14681606 AATTAGGCAGGAGTGGTGGTGGG + Intronic
1163258914 19:16174905-16174927 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1163405826 19:17121627-17121649 CCTTAGGGAGGGCTGGAAGGAGG - Intronic
1163985377 19:20942289-20942311 AATTAGCCAGGTGTGGAGGTGGG - Intronic
1164115654 19:22216284-22216306 CATTAGTCAGGTGTGGTGGTGGG + Intergenic
1164607871 19:29613025-29613047 CCTGAGGCAGGGCAGGAGGAAGG - Intronic
1164615527 19:29665166-29665188 CCTTGGGCAGGGGTGGGGTGGGG - Exonic
1164778343 19:30872208-30872230 CCTGAGGCTGGGGTGGAGCTGGG + Intergenic
1164786366 19:30934316-30934338 AATTAGGCAGGTGTGGTGGTGGG - Intergenic
1164964932 19:32474737-32474759 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1165139093 19:33688470-33688492 CCTTTGCCTGGAGTGGAGGTGGG - Intronic
1165152258 19:33767763-33767785 TCTGTCGCAGGGGTGGAGGTGGG + Intronic
1165389431 19:35529785-35529807 ACTGAGAGAGGGGTGGAGGTGGG + Intergenic
1165635077 19:37333911-37333933 CCGGAGGGTGGGGTGGAGGTGGG - Intronic
1165658420 19:37553279-37553301 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1165663507 19:37604454-37604476 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1165712641 19:38023136-38023158 ACTTAGGCTGGGCTGGAGGCAGG + Intronic
1165833626 19:38741945-38741967 GCCCAGGCAGGGTTGGAGGTTGG - Intronic
1166025605 19:40081382-40081404 AATTAGCCAGGTGTGGAGGTGGG + Intronic
1166117599 19:40665307-40665329 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1166130417 19:40742654-40742676 CCTCTGGCAGGGATGGTGGTTGG + Exonic
1166159383 19:40940525-40940547 TCTTAAGCAGGGGTGTATGTTGG + Intergenic
1166982466 19:46639338-46639360 CCCTAGGAAGAGGTGGAGGTGGG + Intergenic
1167170677 19:47829478-47829500 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1167333284 19:48869245-48869267 CCGTAGGCAGGGGAGGAGAGCGG + Intergenic
1167444458 19:49529030-49529052 AATTAGGCAGGCGTGGTGGTGGG + Intronic
1167504094 19:49862341-49862363 CCTGGGGCGGGGGTGGGGGTGGG - Intronic
1167550168 19:50154811-50154833 CCTGGGGCAGGGGTGGGGGTGGG + Intronic
1167586993 19:50380870-50380892 CATCAGGCAGGGGTGGAGGCAGG - Intronic
1167599385 19:50445539-50445561 AATTAGGCAGGTGTGGTGGTGGG - Intronic
1167636119 19:50656801-50656823 CATTAGGCAGGCGTGGTGGCAGG + Intronic
1167650104 19:50724301-50724323 CCTGAGGGCGGGGTGGCGGTGGG - Intronic
1167885701 19:52498303-52498325 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1168100652 19:54139213-54139235 ACTCAGGCAGGGGTGAAGGGAGG - Intronic
1168160043 19:54504103-54504125 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1168316288 19:55486116-55486138 CCTCAGGCTGGAGTGGAGGCTGG - Intronic
1168640172 19:58025876-58025898 CCTGAGGCTGGGGAGCAGGTGGG + Intergenic
925254621 2:2472550-2472572 CTTTAGGCATGGGTGGAAGATGG - Intergenic
925331412 2:3061665-3061687 CCTTTGTCAGTGGTGGAGCTTGG - Intergenic
926066077 2:9841468-9841490 ACTTAGCCAGGTGTGGTGGTAGG + Intergenic
926074372 2:9929305-9929327 ACTTAGCCAGGTGTGGAGGCGGG - Intronic
926079847 2:9976296-9976318 CCCTCGGCGGGGGTGGTGGTGGG + Intronic
926409653 2:12589961-12589983 CCTTTGCAAGGGGGGGAGGTGGG - Intergenic
926912032 2:17860030-17860052 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
927735243 2:25514829-25514851 AATTAGCCAGGCGTGGAGGTGGG - Intronic
927782796 2:25953118-25953140 CATTAGTCAGGTGTGGTGGTGGG + Intronic
927827998 2:26322988-26323010 AATTAGCCAGGGGTGGTGGTGGG + Intronic
927889909 2:26741763-26741785 CCTTAGGAAGGGGAGGGAGTGGG + Intergenic
927953510 2:27190834-27190856 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
928128348 2:28631249-28631271 ACATAAGCAGGAGTGGAGGTGGG - Intronic
928307628 2:30183521-30183543 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
928374706 2:30765056-30765078 CCATGGGTCGGGGTGGAGGTGGG - Intronic
928588700 2:32790719-32790741 CGTCAGGGTGGGGTGGAGGTGGG - Intronic
928699090 2:33880554-33880576 AATTAGGCAGGTGTGGTGGTGGG + Intergenic
928939909 2:36717314-36717336 CATTAGCCAGGCGTGGTGGTGGG - Intronic
929590665 2:43143692-43143714 CCTGAGGCTGGGGTGGGGGCTGG - Intergenic
929677968 2:43956739-43956761 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
930105099 2:47633118-47633140 CCTCAGGCAGGGCTGGAGCTTGG + Intergenic
930208282 2:48609762-48609784 CCATCTGCAGGGGTGGTGGTAGG + Intronic
930830984 2:55742724-55742746 AATTAGTCAGGGGTGGTGGTGGG - Intergenic
930841162 2:55847105-55847127 CATTAGCCAGGGATGGTGGTGGG + Intergenic
931248934 2:60513472-60513494 CCTTTGGCAGGTGTGGGTGTTGG + Intronic
931380358 2:61747284-61747306 GCTTATCCAAGGGTGGAGGTGGG + Intergenic
931518829 2:63073133-63073155 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
932519982 2:72401311-72401333 AATTAGGCAGGTGTGGTGGTGGG + Intronic
932750853 2:74370825-74370847 CCTGAGGAAGAAGTGGAGGTGGG + Exonic
933671699 2:85013836-85013858 TCCTAGGCAGGGGTGGGGGAGGG + Intronic
933990782 2:87632610-87632632 CAATAGGCAGGGGTGGATGTGGG + Intergenic
934488487 2:94739109-94739131 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
934919875 2:98334197-98334219 GCTGTGGCAGGGGTGGGGGTGGG + Intronic
935878058 2:107534054-107534076 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
935962986 2:108445479-108445501 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
936053160 2:109240843-109240865 CCAAGGGCAGGGGTGGGGGTGGG - Intronic
936303060 2:111318213-111318235 CAATAGGCAGGGGTGGATGTGGG - Intergenic
936851281 2:116900906-116900928 CATTAGCCAGGTGTGGTGGTAGG - Intergenic
937072235 2:119073200-119073222 TCTTGGGCAGGGGTGGGGGAGGG + Intergenic
937123341 2:119456207-119456229 AATTAGTCAGGGGTGGTGGTGGG - Intronic
937224924 2:120363247-120363269 CCTGAGGCAGAGCTGGAGGCAGG + Intergenic
938032297 2:128005464-128005486 AATTAGCCAGGGGTGGTGGTGGG + Intronic
938063662 2:128269888-128269910 CCCTGGGCAGGGGTGGGGGTGGG + Intronic
938094127 2:128450641-128450663 CCTAAGTCAGGGGCGGAAGTGGG - Intergenic
938130906 2:128715108-128715130 CCTGAGGCAGGAGTGGGGATGGG - Intergenic
938341557 2:130539689-130539711 CCTGAGGCAGGGGTGGCCTTGGG + Exonic
938348272 2:130581020-130581042 CCTGAGGCAGGGGTGGCCTTGGG - Intronic
938394175 2:130930039-130930061 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
938970937 2:136431784-136431806 CCCTGAGCAGGGGTGGGGGTGGG + Intergenic
939441005 2:142249263-142249285 CGATAGGTAGGGGTGGAGTTTGG - Intergenic
939714384 2:145565393-145565415 CCTAAGACACAGGTGGAGGTAGG + Intergenic
939980554 2:148775924-148775946 AATTAGGCAGGTGTGGTGGTGGG - Intronic
940005778 2:149008349-149008371 CCAAAGTCAGGGGTGGAGGCAGG - Intronic
941529968 2:166655909-166655931 CCTTGGCCAAGGGTGGAGGGTGG + Intergenic
941645788 2:168039638-168039660 CCTTTGCCAGAGGTGGAGGGAGG + Intronic
942150847 2:173075301-173075323 CCTAAGCCAAAGGTGGAGGTGGG - Intergenic
942306245 2:174610215-174610237 ACGTATGCAGGGGTGGTGGTAGG + Intronic
944037361 2:195311011-195311033 CTTTAGGAATGGGTTGAGGTGGG - Intergenic
945144315 2:206721002-206721024 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
946172173 2:217902088-217902110 GATTAGACAGGGGTGGAGCTGGG + Intronic
946297515 2:218797246-218797268 CATTAGCCAGGTGTGGTGGTGGG - Intronic
946588344 2:221216018-221216040 CCTTAGACAGGCATGGTGGTGGG - Intergenic
947763064 2:232617798-232617820 CATTAGCCAGGTGTGGTGGTGGG + Intronic
947968479 2:234302116-234302138 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
948155828 2:235780118-235780140 CAGGAGGTAGGGGTGGAGGTGGG - Intronic
948387502 2:237590760-237590782 CCTGAGGCAGGGCAGGAGGCTGG + Exonic
948499489 2:238381392-238381414 CCATAGGCATGGGTGGCGGGTGG + Intronic
948674648 2:239589745-239589767 CTATTGGCAGGGATGGAGGTAGG + Intergenic
948674663 2:239589806-239589828 CTATCGGCAGGGATGGAGGTAGG + Intergenic
948674678 2:239589867-239589889 CTATCGGCAGGGATGGAGGTAGG + Intergenic
1169044282 20:2523827-2523849 TCTTAGCCAGGCGTGGTGGTGGG - Intronic
1169253338 20:4077408-4077430 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1170352162 20:15453658-15453680 GCTTAGGAAGGGGCTGAGGTGGG + Intronic
1170527064 20:17249356-17249378 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1170635885 20:18104021-18104043 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1171757370 20:29123314-29123336 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1172370496 20:34386245-34386267 CCTTAGCCAGGTGTGGTGGCAGG - Intronic
1173177645 20:40776847-40776869 TCTGGGGCAGAGGTGGAGGTGGG - Intergenic
1173256266 20:41396019-41396041 CCTTGGGCAGGGGTTGGGGGCGG - Intergenic
1173824553 20:46039624-46039646 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1173856462 20:46253405-46253427 CCATAGGGAGGGATGGAGGGAGG + Intronic
1173922486 20:46756971-46756993 CCCTACGCTGGGGTGGAGGGGGG - Intergenic
1174387867 20:50197883-50197905 CCTCATGCAGGGGTGGAGTAGGG + Intergenic
1174387886 20:50197931-50197953 CCTCATGCAGGGGTGGAGCGGGG + Intergenic
1174387942 20:50198077-50198099 CCTCATGCAGGGGTGGAGTGGGG + Intergenic
1174455999 20:50649294-50649316 CATTAGCCAGGGGTGGTGGTGGG + Intronic
1174689529 20:52490086-52490108 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1174699864 20:52597435-52597457 CCTTTGGCTGAGGTGGGGGTGGG + Intergenic
1175112516 20:56658477-56658499 CTTTGGTGAGGGGTGGAGGTTGG + Intergenic
1175472384 20:59239983-59240005 TCTTAGGCAGGGGTGGGGGCTGG - Intronic
1175977714 20:62720149-62720171 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
1175979182 20:62728371-62728393 CCTGAGGAGGGGGTGGAGCTGGG + Intronic
1176148275 20:63574925-63574947 CATTAGCCAGGGGTGGGGGCGGG + Intergenic
1176273878 20:64252657-64252679 CCTGAGGCAGGGGTGCGGCTGGG - Intergenic
1176310294 21:5145707-5145729 CGTTTGGCAAGGGTGGAGGGAGG - Intronic
1176387470 21:6145912-6145934 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1176718260 21:10372688-10372710 CATTAGGCGGGCGTGGTGGTGGG + Intergenic
1176851743 21:13923440-13923462 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1177628550 21:23698073-23698095 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1177766091 21:25459131-25459153 GCCTATGCAGGGGTGGAGGTAGG + Intergenic
1178533479 21:33393947-33393969 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1179736002 21:43392336-43392358 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1179837114 21:44043360-44043382 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1179846761 21:44116328-44116350 CATTTGGCAAGGGTGGAGGGAGG + Intronic
1179983381 21:44907804-44907826 CCGCAGGCAGGGGGGCAGGTGGG + Intronic
1180082775 21:45494256-45494278 CCTGAAGCAGGGGTGGAGGGTGG - Intronic
1180260146 21:46662935-46662957 GCTTAGGCAAGGGTGCAGGAAGG + Intronic
1180707791 22:17819792-17819814 AATTAGGCAGGTGTGGTGGTGGG + Intronic
1180719249 22:17894646-17894668 AATTAGCCAGGCGTGGAGGTGGG + Intronic
1180735848 22:18016789-18016811 ACTTAGCCGGGGGTGGTGGTGGG + Intronic
1180848075 22:18995218-18995240 CCTGGGGCAGGGCTGGAGGAGGG + Intergenic
1180944745 22:19686033-19686055 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1181030574 22:20147306-20147328 CCTGGGGCAGGGCTGGGGGTGGG + Exonic
1181463587 22:23099115-23099137 CCTTCGCCAGGCGTGGGGGTGGG - Intronic
1181512732 22:23396072-23396094 CCTGGGGCAGGGCTGGGGGTGGG - Intergenic
1181553060 22:23652106-23652128 AATTAGGCAGGTGTGGTGGTGGG - Intergenic
1181636704 22:24177938-24177960 CCTGGGGCAGGGGTGAGGGTGGG + Intronic
1182316238 22:29449199-29449221 AATTAGGCAGGTGTGGTGGTGGG + Intergenic
1182424315 22:30264094-30264116 TCCGAGGCAGGGGTGGGGGTGGG + Exonic
1182514372 22:30845280-30845302 ACTTAGCCAGGCGTGGTGGTAGG + Intronic
1182828687 22:33286928-33286950 CCCTTGCCAGGGGTGCAGGTAGG - Intronic
1183210752 22:36449794-36449816 GCTTGGGTGGGGGTGGAGGTGGG + Intergenic
1183302626 22:37065790-37065812 CATTAGGCAGCAGTGGAGGAAGG + Exonic
1183458489 22:37935699-37935721 CCTTAGCCAAGCGTGGTGGTGGG - Intronic
1183497686 22:38158316-38158338 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1183679891 22:39321896-39321918 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1183866751 22:40710324-40710346 CCAGAGGCAGGGGTTGAGGGAGG + Intergenic
1183878208 22:40802494-40802516 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1183960451 22:41408702-41408724 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1184113235 22:42407515-42407537 CATTAGCCAGGTGTGGTGGTAGG - Intronic
1184678196 22:46054564-46054586 CCTGCAGCAGGGGTGGAGGGTGG + Intronic
1184732331 22:46377792-46377814 CCTCAGGCGGGGCTGGAGGAGGG - Intronic
1184803846 22:46779405-46779427 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1185224219 22:49643906-49643928 CCTTAGGATGGGGTGGGGGCAGG - Intronic
949594799 3:5532317-5532339 CCTTAGGCAGGCGCTGTGGTTGG + Intergenic
949735935 3:7171683-7171705 ACTTAGGCAGGTGTGTAGGACGG - Intronic
949943687 3:9173754-9173776 ATTATGGCAGGGGTGGAGGTGGG - Intronic
949966920 3:9364493-9364515 CATTAGCCAGGTGTGGTGGTGGG - Intronic
950007860 3:9703074-9703096 CCATAGGCAGGGCTCAAGGTAGG - Intergenic
950102573 3:10367045-10367067 CCCCAGGCACGGGTGGAGGAGGG - Intronic
950593120 3:13953398-13953420 ACTTAGCCAGGTGTGGCGGTGGG + Intronic
950675619 3:14552562-14552584 CCATAGGTAGGGTTGGAGGAAGG - Intergenic
950701825 3:14755878-14755900 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
950940007 3:16883744-16883766 GCTGAGGCAGGGGTGAAGGCTGG - Intronic
952456240 3:33474611-33474633 AATTAGCCAGGGGTGGAGGCAGG + Intergenic
952881222 3:37987289-37987311 CCTTGAAGAGGGGTGGAGGTGGG + Intergenic
952934981 3:38390360-38390382 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
952968024 3:38633002-38633024 GGGTAGGCAGGGCTGGAGGTGGG + Intronic
953976125 3:47382835-47382857 AATTAGGCAGGGGTGGTGGCGGG - Intronic
954614346 3:51961895-51961917 CTTGAGGCAGGGGTTGAGGGGGG + Intronic
955068428 3:55552256-55552278 CCTTGGCCAGGGGTGGGGTTGGG + Intronic
955071945 3:55578926-55578948 TCTGAGTGAGGGGTGGAGGTGGG + Intronic
955211267 3:56943764-56943786 CATTAGCCAGGTGTGGTGGTGGG + Intronic
955230501 3:57095036-57095058 CCTGAGGCAAGGTGGGAGGTGGG - Exonic
955826492 3:62952729-62952751 ACTTAGCCAGGTGTGGTGGTAGG - Intergenic
956103140 3:65789300-65789322 CCTTTGGGAGTGGTGGGGGTGGG - Intronic
956304495 3:67809049-67809071 CAGTTGGCAGGGGTGGGGGTAGG - Intergenic
956773488 3:72546675-72546697 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
956784389 3:72630352-72630374 CCTAAGGCAGAGGTGGATTTGGG - Intergenic
957325954 3:78695111-78695133 CTTTAGGCTGGGGTGGGGGGAGG + Intronic
957386029 3:79498703-79498725 AATTAGCCAGGTGTGGAGGTGGG + Intronic
957784721 3:84867600-84867622 AATTAGCCAGGGGTGGTGGTTGG - Intergenic
958442683 3:94175580-94175602 CCATAGGTAGGTGTGGGGGTTGG + Intergenic
958609069 3:96400963-96400985 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
958863086 3:99468218-99468240 GCTTAGACAGGGGTGGTGGGTGG - Intergenic
959563329 3:107807802-107807824 CCTTAGGCAGGGTTGGGGGTGGG + Intronic
962326187 3:134434522-134434544 CCTGAGGCTGGGGTGGTGGGAGG - Intergenic
962670801 3:137706680-137706702 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
962783487 3:138744244-138744266 CATTAGCCAGGCGTGGTGGTGGG + Intronic
962881619 3:139582491-139582513 ATTTAGGCAGGTGTGGTGGTGGG + Intronic
962893367 3:139692422-139692444 TCTTTGGCATGAGTGGAGGTGGG + Intergenic
963267489 3:143253816-143253838 CCTTATGCAAGGGAGGAGGCTGG - Intergenic
963287214 3:143444853-143444875 CCTTTGGCTGTGGTGGATGTTGG + Intronic
963440699 3:145335713-145335735 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
963969496 3:151413996-151414018 AATTAGCCAGGGGTGGTGGTGGG - Intronic
964220580 3:154339936-154339958 AATTAGGCGGGGGTGGTGGTGGG - Intronic
965499590 3:169441877-169441899 CATTAGCCAGGCGTGGTGGTGGG - Intronic
965630221 3:170725338-170725360 CACTTGGAAGGGGTGGAGGTTGG - Intronic
965795597 3:172435706-172435728 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
966896347 3:184448073-184448095 AATTAGCCAGGGGTGGTGGTGGG - Intronic
967094825 3:186168699-186168721 CATTAGCCAGGTGTGGTGGTGGG + Intronic
967104185 3:186242223-186242245 GCTTTTGCAGGGGAGGAGGTGGG - Intronic
967161083 3:186738695-186738717 AATTAGCCAGGCGTGGAGGTGGG + Intronic
967482710 3:189992241-189992263 AATTAGGCAGGTGTGGTGGTGGG - Intronic
967593985 3:191309308-191309330 ACTTAGCCAGGCGTGGTGGTAGG - Intronic
967801525 3:193667520-193667542 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
968197315 3:196718159-196718181 CATTAGCCAGGCGTGGTGGTGGG + Intronic
968290928 3:197539286-197539308 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
968368145 3:198203140-198203162 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
968568306 4:1326621-1326643 CCTGAGGCAGGGGCGGGGGTGGG - Intronic
968595130 4:1478243-1478265 CCTTCGGTGGGGGTGGAGGTGGG - Intergenic
968700331 4:2053778-2053800 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
968785670 4:2620698-2620720 AATTAGCCAGGGGTGGTGGTGGG + Intronic
968986938 4:3880632-3880654 CCTCTGGCAGGGGTGGAGGTTGG - Intergenic
969009537 4:4050496-4050518 ACTTAGCCAGGAGTGGTGGTGGG - Intergenic
969176793 4:5405013-5405035 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
969194957 4:5553536-5553558 TCTATGGCTGGGGTGGAGGTAGG + Intronic
969308358 4:6338395-6338417 CCTGAGCCAGGGATGGGGGTGGG - Intronic
969661758 4:8534157-8534179 CCTCAGGCAGGGGTGGAAGGAGG + Intergenic
969727161 4:8927149-8927171 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
969744816 4:9061815-9061837 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
970385258 4:15549652-15549674 CATTAGCCAGGCGTGGTGGTGGG + Intronic
970565693 4:17330448-17330470 AATTAGCCAGGTGTGGAGGTGGG + Intergenic
970655988 4:18230375-18230397 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
970747773 4:19320187-19320209 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
971360448 4:25933539-25933561 TCTTAGGGAGGGATAGAGGTAGG + Intergenic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
972073953 4:35060004-35060026 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
972099153 4:35390828-35390850 ACTTAGCCAGGCGTGGTGGTAGG - Intergenic
972555307 4:40175388-40175410 CCTGGGGCAGGGTGGGAGGTAGG + Intergenic
973708210 4:53600877-53600899 CATTAGCCAGGTGTGGTGGTGGG - Intronic
973753075 4:54043270-54043292 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
973819255 4:54648382-54648404 GGTTAGGAAGTGGTGGAGGTAGG - Intergenic
974002455 4:56525335-56525357 AATTAGCCAGGGGTGGTGGTAGG + Intergenic
974703633 4:65483533-65483555 CGTTAGGGAGGGAAGGAGGTGGG + Intronic
975517260 4:75260367-75260389 CCTCAGGTAGGGGTGGGGCTAGG - Intergenic
976152276 4:82104393-82104415 AATTAGGCAGGCGTGGTGGTGGG + Intergenic
977165516 4:93690293-93690315 TCTGAGGCAGGTGTGGAGGAAGG + Intronic
977695710 4:99962966-99962988 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
977965621 4:103144083-103144105 AATTAGGCAGGCGTGGTGGTGGG - Intronic
978755048 4:112292857-112292879 AATTAGCCAGGGGTGGTGGTGGG - Intronic
979256573 4:118612860-118612882 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
979331777 4:119427680-119427702 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
979541354 4:121887098-121887120 CCTCAGGCGTGGGTAGAGGTAGG + Intronic
980051568 4:128044973-128044995 AATTAGGCAGGCGTGGTGGTGGG + Intergenic
980070057 4:128234522-128234544 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
980156822 4:129117771-129117793 CCTTAAGCAGGGGTGGGGGTTGG - Intergenic
980226611 4:129995742-129995764 AATTAGGCAGGTGTGGTGGTGGG - Intergenic
980693743 4:136329243-136329265 CCTCAGGCAGGGGCTGTGGTTGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981023910 4:140056659-140056681 AATTAGCCAGGGGTGGTGGTGGG + Intronic
981333862 4:143545089-143545111 AATTAGCCAGGGGTGGTGGTGGG - Intronic
982039773 4:151385248-151385270 CCACAGACTGGGGTGGAGGTGGG + Intergenic
982846522 4:160259747-160259769 TCTTTGGGAGGGGAGGAGGTTGG - Intergenic
983350582 4:166582685-166582707 CGTTAGCCAGGTGTGGTGGTGGG - Intergenic
983705116 4:170648305-170648327 CCTTACGCAGGGGAGGAGCCAGG - Intergenic
984823352 4:183903833-183903855 CCTTGGACTGGGGTGGGGGTAGG + Intronic
985014250 4:185616895-185616917 AATTAGCCAGGGGTGGTGGTGGG - Intronic
985587559 5:748814-748836 ACTTAGGAAGGGGTGGATGCTGG - Intronic
985919944 5:2962643-2962665 CCTTATGCTGGGGAGGAGCTCGG - Intergenic
986393817 5:7308375-7308397 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
986835326 5:11630803-11630825 CATTAGCCAGGCGTGGTGGTGGG + Intronic
987393760 5:17401583-17401605 CCCCAGGCAGGGGTGCAGGGTGG - Intergenic
987654479 5:20788631-20788653 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
988478660 5:31610836-31610858 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
989195168 5:38709308-38709330 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
989258204 5:39389658-39389680 AATTAGCCAGGGGTGGTGGTGGG - Intronic
990380566 5:55218655-55218677 TCTGAGGCAGGGGTTGGGGTGGG - Intergenic
990423085 5:55657007-55657029 AATTAGCCAGGGGTGGTGGTGGG - Intronic
990443150 5:55866526-55866548 TCTGAGGCAGGGGTAGGGGTGGG + Intronic
990555891 5:56935216-56935238 CCTTGGGCAGGGTTGGGGGTGGG + Intronic
990599205 5:57340388-57340410 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
991051944 5:62282219-62282241 CAATAGGCAGTGGAGGAGGTTGG + Intergenic
991405281 5:66295204-66295226 CCTGATGAAGGGGTGGAGGGAGG + Intergenic
991637055 5:68716635-68716657 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
991688945 5:69207658-69207680 CATTAGCCAGGTGTGGTGGTGGG + Intronic
992222277 5:74584827-74584849 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
992382640 5:76253686-76253708 CCTTAGGGAGGAGAGGTGGTGGG - Intronic
992476033 5:77102521-77102543 CCTGAGGCAGGGCAGGAGCTAGG + Intergenic
993368988 5:87068765-87068787 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
994364058 5:98891220-98891242 ACTTAGCCAGGAGTGGTGGTGGG - Intronic
994786168 5:104166879-104166901 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
994808957 5:104488608-104488630 GCTTTGGCATGGGAGGAGGTAGG - Intergenic
994979479 5:106855128-106855150 CCTTATGCAAGGGAGGAGCTGGG + Intergenic
995033456 5:107506601-107506623 CCTGAGGCAGGTGTGGAGGGTGG + Intronic
995611706 5:113917494-113917516 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
995796388 5:115945817-115945839 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
996109055 5:119543262-119543284 CCTGTTGCAGGGGTGAAGGTGGG - Intronic
996557950 5:124798053-124798075 CCTTCGGCGGGGGTGGAGCATGG + Intergenic
997166749 5:131668534-131668556 AATTAGGCAGGTGTGGTGGTGGG + Intronic
997472396 5:134124170-134124192 GCTTTGGCAGGGGTGGAGGGTGG + Intronic
997486694 5:134236924-134236946 ATTTAGGCAGGCGTGGTGGTGGG + Intergenic
998159469 5:139805207-139805229 CCAAGGGCAGGGCTGGAGGTGGG - Intronic
998473189 5:142399236-142399258 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
998623313 5:143818363-143818385 CTTTGAGTAGGGGTGGAGGTGGG - Intronic
998668356 5:144324919-144324941 CCTGTGGCAGGGGTGAAGGGAGG + Intronic
999278725 5:150350181-150350203 CCTTTGGTAGGGGTGGAGACAGG - Intergenic
999282743 5:150375754-150375776 CCCTTGGCAGGACTGGAGGTGGG - Exonic
999458839 5:151740428-151740450 GCTTCTGCAGGGGTGGGGGTGGG - Intergenic
999937417 5:156502193-156502215 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1000785439 5:165537463-165537485 AATTAGGCAGGTGTGGTGGTGGG + Intergenic
1001069163 5:168569331-168569353 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1001656243 5:173352612-173352634 CCTGAGGGAGGTGTGCAGGTAGG + Intergenic
1001979121 5:176026065-176026087 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1002092770 5:176814577-176814599 CCCTTTGCAGGGGAGGAGGTGGG - Intronic
1002238295 5:177817699-177817721 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1002358312 5:178648950-178648972 CCTTAGCCAGGCGTGGTGGCGGG + Intergenic
1002416421 5:179123110-179123132 CCCTGGGCAGGGGTTGAGGTGGG + Intronic
1002727364 5:181308368-181308390 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1002860583 6:1076262-1076284 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1003714589 6:8632215-8632237 CCACAGACAGGGGTGGGGGTTGG + Intergenic
1003887255 6:10532769-10532791 CCTGAGGCAGGGCTGAATGTAGG + Intronic
1003904003 6:10682017-10682039 CCTTATGCAGGGGAGGAGCCTGG + Intronic
1004126932 6:12883134-12883156 CCTCAGGCAGGGGCTGGGGTGGG - Intronic
1004408198 6:15354841-15354863 CCTTAGACTGGGGTATAGGTTGG + Intronic
1004434586 6:15578097-15578119 CCTTAGGCAGGAGAGAAGGAAGG + Intronic
1004441372 6:15658444-15658466 CACTGGGCAGGGGTGCAGGTGGG + Intronic
1004514192 6:16308003-16308025 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
1004514827 6:16313703-16313725 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1004672451 6:17810395-17810417 CATTAGGCAGGGGTTGTGGGAGG - Intronic
1004750541 6:18557698-18557720 CCTTTAGATGGGGTGGAGGTGGG + Intergenic
1005007323 6:21301055-21301077 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1005079276 6:21940650-21940672 CATTAGCCAGGGGTGGTGGCGGG - Intergenic
1005948447 6:30613036-30613058 GCTTAGGATGAGGTGGAGGTAGG - Intronic
1006155617 6:32011439-32011461 CCTCAGCCAGCGGTGGGGGTGGG - Intergenic
1006161948 6:32044293-32044315 CCTCAGCCAGCGGTGGGGGTGGG - Intronic
1006676621 6:35769218-35769240 CATCAGGCAGGTGAGGAGGTAGG - Intergenic
1007167036 6:39835961-39835983 CCTAGGGCAGGGTTGGGGGTGGG + Intronic
1007412841 6:41674824-41674846 CACTAGGAAGGGGAGGAGGTGGG + Intergenic
1007731794 6:43951902-43951924 CCTCAGGCAGGGGTGGGGAGTGG - Intergenic
1009504655 6:64461105-64461127 CCTCAGGCAATGTTGGAGGTTGG + Intronic
1010228478 6:73513941-73513963 AATTAGGCAGGTGTGGTGGTGGG + Intergenic
1010234004 6:73559831-73559853 ACTTAGCCAGGCGTGGAGGCGGG - Intergenic
1010266483 6:73873947-73873969 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1010342216 6:74767142-74767164 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1010711725 6:79182453-79182475 CCAAAGGCAGGGGTAGTGGTGGG + Intergenic
1010964800 6:82192596-82192618 CATTAGTCAGGGGTGGTGGCAGG + Intronic
1011412570 6:87081375-87081397 CCTCAGGCAGAGGTGGAGTGGGG - Intergenic
1011508687 6:88076512-88076534 CCAGAGGAAGGAGTGGAGGTGGG + Intergenic
1011524819 6:88253225-88253247 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1012532520 6:100255037-100255059 CCAAGGGCAGGGGTGGAGGAGGG + Intergenic
1013452853 6:110302127-110302149 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1014010441 6:116469419-116469441 CCACAGACAGGGGTGGGGGTGGG + Intergenic
1014735948 6:125096510-125096532 AATTAGCCAGGTGTGGAGGTGGG - Intergenic
1015323039 6:131897352-131897374 CCCTAGGCATGGCGGGAGGTGGG - Intergenic
1015363900 6:132375572-132375594 CATTAGCCAGGCGTGGCGGTGGG - Intronic
1015653733 6:135493892-135493914 ACTTAGTCAGGCGTGGTGGTGGG + Intronic
1015909664 6:138157274-138157296 CCTGAGTCAGTGGTTGAGGTTGG - Intergenic
1016172738 6:141040292-141040314 CCTTAGGCAGGGAAGGAGCTTGG + Intergenic
1016411159 6:143785647-143785669 CCATGGGCAGGGTTGGGGGTGGG - Intronic
1016526487 6:145007145-145007167 CCTTAGGGAGGTGATGAGGTCGG + Intergenic
1016861098 6:148719691-148719713 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1016920899 6:149291710-149291732 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1017161404 6:151369229-151369251 CTTTAGGCAGGCCTGGAGGGAGG + Intronic
1017475775 6:154790657-154790679 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1017925007 6:158903301-158903323 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1018897991 6:168034599-168034621 CCTTAGGCAGGGGTGGAGGTGGG + Intronic
1018927296 6:168215241-168215263 CCTCTGGCAGGGGTGGAGAAAGG - Intergenic
1019550798 7:1601508-1601530 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1019871003 7:3761403-3761425 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1020071862 7:5232461-5232483 CATTAGGCAGAGGTGCAAGTGGG + Exonic
1020167009 7:5815140-5815162 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1020190121 7:5989280-5989302 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1020250624 7:6465330-6465352 ACTTAGCCAGGCGTGGTGGTGGG - Intronic
1020466502 7:8485593-8485615 AGATAGGTAGGGGTGGAGGTGGG + Intronic
1021178871 7:17483071-17483093 AATTAGGCAGGGGTGGTGGCAGG + Intergenic
1021674841 7:23069614-23069636 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1021719034 7:23488328-23488350 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1022114157 7:27248175-27248197 CTTTGGGCTGGGGTGGAGGCAGG - Intergenic
1022159322 7:27693101-27693123 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1022476902 7:30716928-30716950 CCTTAGGTAGAGCTGGGGGTGGG - Intronic
1022761055 7:33351797-33351819 CCTTACGCAGGGGAGGAGCCTGG - Intronic
1023105153 7:36756504-36756526 CCTTGGGAGGGGTTGGAGGTGGG + Intergenic
1023203195 7:37720590-37720612 AATTAGCCAGGGGTGGTGGTGGG + Intronic
1024437353 7:49374707-49374729 CCTTATGCAGGGGAGGAGCCTGG + Intergenic
1024886278 7:54146393-54146415 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1025189370 7:56884960-56884982 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1025682570 7:63691957-63691979 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1025862272 7:65342056-65342078 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1026801681 7:73404200-73404222 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1026804511 7:73421661-73421683 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1026850953 7:73722879-73722901 GCTGGGGCAGGGGTGGGGGTGGG + Intergenic
1026949345 7:74337223-74337245 CCTTAGGCTGGGCTGCAGCTTGG + Intronic
1026976793 7:74503598-74503620 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1026982533 7:74535239-74535261 CCTCAGGCAGGGAGGGAGGCTGG + Intronic
1027198434 7:76047616-76047638 CCTTAGGCGGGGTGGGAGGAAGG - Intronic
1027885974 7:83905185-83905207 CCTTGGACAGGAGTGGAGGCTGG + Intergenic
1028198454 7:87934184-87934206 CCTTTGCCAGGGGATGAGGTGGG + Intronic
1028201102 7:87962872-87962894 GTTTAGGAAGGGGTGGAGCTAGG + Intronic
1028382662 7:90215919-90215941 AATTAGGCAGGGGTGGTGGCAGG - Intronic
1028440512 7:90854392-90854414 CATTAGCCAGGGGTGGCGGCAGG + Intronic
1029005356 7:97203412-97203434 CATTAGGCAGGCATGGTGGTGGG + Intergenic
1029068498 7:97876003-97876025 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1029250230 7:99231094-99231116 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
1029590617 7:101504461-101504483 GCATAGACAGGGGAGGAGGTTGG - Intronic
1029650862 7:101890421-101890443 CCCAAGGCGGGGGTGGAGGGGGG - Intronic
1030653542 7:112141551-112141573 CCTTGGGCAGGAGTTGATGTTGG - Intronic
1030731400 7:112993783-112993805 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1031829510 7:126608910-126608932 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1031982059 7:128134476-128134498 ACTTAGCCAGGCGTGGTGGTAGG + Intergenic
1032048881 7:128633607-128633629 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1032385404 7:131519318-131519340 CTTTAGGTATGGGTGGGGGTAGG + Intronic
1032596295 7:133244456-133244478 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1032806373 7:135358883-135358905 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1033209477 7:139450189-139450211 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1033318738 7:140320429-140320451 ACTTAGCCAGGTGTGGTGGTGGG + Intronic
1033538502 7:142334110-142334132 CCAGAGGCTGGGGTGGAGATGGG + Intergenic
1034021016 7:147642199-147642221 CCTGGGGTAGGGGTGGAGGTGGG + Intronic
1034303144 7:150033547-150033569 CCTAAGCCAGGGGTGGAAGAGGG + Intergenic
1034524566 7:151649272-151649294 ACTTAGCCAGGTGTGGTGGTAGG - Intronic
1034618949 7:152442164-152442186 CATTAGGCAGGTGTGATGGTGGG - Intergenic
1034631821 7:152536972-152536994 AATTAGCCAGGTGTGGAGGTGGG + Intergenic
1034809095 7:154114925-154114947 CATGAGGCAGGAGTGGAGGAAGG + Intronic
1035216775 7:157373497-157373519 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1035231691 7:157469502-157469524 CCTTGGTCGGGGGTGGAGGGGGG - Intergenic
1035710549 8:1710066-1710088 CCTAAGGCAGGGGTGGGGAGGGG + Intergenic
1035934828 8:3825378-3825400 AATTAGCCAGGGGTGGTGGTAGG + Intronic
1036255148 8:7200085-7200107 AGTTAGCCAGGCGTGGAGGTAGG + Intergenic
1036293605 8:7517469-7517491 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1036328956 8:7803526-7803548 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1036884213 8:12539380-12539402 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1036934848 8:12991780-12991802 ACTTAGCCAGGCGTGGTGGTGGG + Intronic
1036978936 8:13446791-13446813 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1037386932 8:18352847-18352869 CCTTTGGCAGTGGTGGGGGGCGG - Intergenic
1037386973 8:18353220-18353242 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1037432716 8:18830706-18830728 CCTTCCGAAGGGGTGGAGTTCGG - Intronic
1037965059 8:23127815-23127837 CCTGAGGCCGGGGCAGAGGTAGG - Intergenic
1038822080 8:30961486-30961508 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1039144854 8:34436312-34436334 AGTTAGGCAGGTGTGGTGGTGGG - Intergenic
1039463408 8:37764468-37764490 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
1039465951 8:37784885-37784907 CCTGGGGCAGGGGTGGGGATGGG + Intronic
1039769126 8:40665055-40665077 CCCTAGCCAGGCGTGGTGGTGGG + Intronic
1039943195 8:42108756-42108778 CCAGAGGGAGGGGTGGAGCTGGG + Intergenic
1039971851 8:42326951-42326973 CCTGGGGCAGGGGAGGAGGTTGG + Intronic
1040472282 8:47744168-47744190 CCCTTGGCAGGGGTGGAGGGTGG + Intergenic
1040550992 8:48437496-48437518 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1040994151 8:53384697-53384719 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1041292869 8:56323522-56323544 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1041351605 8:56952631-56952653 CCTTATGCAGGGGAGGGGGCTGG + Intergenic
1041445609 8:57948353-57948375 AAAGAGGCAGGGGTGGAGGTGGG + Intergenic
1042127106 8:65549309-65549331 AATTAGGCAGGTGTGGTGGTGGG - Intergenic
1042269076 8:66937571-66937593 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1043396434 8:79842368-79842390 ACTTAGGCAAGGCAGGAGGTTGG + Intergenic
1044168092 8:89014320-89014342 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1044740742 8:95323681-95323703 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1045768377 8:105704504-105704526 ACCTTGGCAGGGGTGGGGGTTGG - Intronic
1045939800 8:107726487-107726509 ACTTAGCCAGGTGTGGTGGTGGG + Intergenic
1046236553 8:111431003-111431025 CCTTAGGTAGATGTGGAGATAGG - Intergenic
1047170365 8:122486773-122486795 CCTGGGGAAGGGGTGGAGATGGG - Intergenic
1047196912 8:122729871-122729893 CCTGAAGCAGGGATGGATGTGGG - Intergenic
1047391879 8:124458997-124459019 ACTTAGCCAGGGGTGGTGGTGGG + Intronic
1048748107 8:137638022-137638044 TCTAAGGCAGGGGAAGAGGTTGG - Intergenic
1048898929 8:139019809-139019831 CCTGAGGCAGGGGTGGAAGCTGG + Intergenic
1049428137 8:142546556-142546578 CCTTCTGCAGGGGAGGAGCTGGG - Intergenic
1049431999 8:142569525-142569547 CCATGGGCAGGGGTGGTGGGTGG - Intergenic
1049606797 8:143533286-143533308 TCTGAGGCCGAGGTGGAGGTGGG - Intronic
1049641803 8:143719287-143719309 CCAGAGGCAGAGGTGGGGGTGGG - Intronic
1049661254 8:143820607-143820629 CCTTAGTCAGGGCTAGAGGGGGG - Intronic
1049699770 8:144005028-144005050 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1049720512 8:144113429-144113451 CCTCAGGCAGTGCTGGAGGTGGG - Exonic
1049869573 8:144963916-144963938 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1050126954 9:2367438-2367460 CCTTTGGGAGGTGTGGAGGAAGG + Intergenic
1050233529 9:3554396-3554418 GACTAGGCAGGGGTAGAGGTGGG - Intergenic
1050519199 9:6479465-6479487 GCTTTGGCAGGGTTGGGGGTGGG - Intronic
1050541917 9:6677905-6677927 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1050648159 9:7744656-7744678 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1050812456 9:9765807-9765829 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1050931309 9:11330677-11330699 CACCAGGCAGGGGTGGAGCTGGG - Intergenic
1051101071 9:13522429-13522451 CCTTAGGAAGGGAAGGAAGTCGG - Intergenic
1051512166 9:17890093-17890115 CATTAGGCAGTGGTGGGGGGAGG - Intergenic
1051674452 9:19545785-19545807 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1051734747 9:20186905-20186927 CTTTGGGCAGGGGTGTGGGTGGG + Intergenic
1053054544 9:34986771-34986793 CCGTGGGCAGGGGTGGGGGTGGG - Intergenic
1053238272 9:36475504-36475526 ACTTAGCCAGGTGTGGTGGTGGG - Intronic
1053442918 9:38130685-38130707 CCATACTCAGAGGTGGAGGTTGG + Intergenic
1053669302 9:40345255-40345277 AATTAGGCAGGCGTGGTGGTGGG + Intergenic
1053670839 9:40359531-40359553 ATTTAGGCAGGCGTGGTGGTGGG - Intergenic
1053919103 9:42971495-42971517 AATTAGGCAGGCGTGGTGGTGGG + Intergenic
1054381959 9:64499594-64499616 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1054513774 9:66016770-66016792 ATTTAGGCAGGCGTGGTGGTGGG + Intergenic
1055056206 9:72026672-72026694 ACTTAGCCAGGCGTGGTGGTGGG - Intergenic
1055512499 9:77009051-77009073 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1056025523 9:82490822-82490844 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1057172527 9:92971722-92971744 CCCTAGCCAGGTGTGGTGGTGGG - Intronic
1057266397 9:93620591-93620613 CATTAGTGAGGGGTTGAGGTTGG + Intronic
1057334162 9:94142805-94142827 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1057639902 9:96809438-96809460 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1058441647 9:105013878-105013900 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1059156975 9:111998588-111998610 AATTAGCCAGGGGTGGTGGTGGG + Intergenic
1059684844 9:116625283-116625305 ACTTAGTCAGGTGTGGTGGTGGG + Intronic
1059696051 9:116731569-116731591 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1060025366 9:120166241-120166263 GATTAGCCAGGGGTGGTGGTGGG - Intergenic
1060067817 9:120519024-120519046 AATTAGCCAGGCGTGGAGGTGGG + Intronic
1060199957 9:121646517-121646539 CTCTGGGCAGGGGTGGGGGTGGG - Intronic
1060247220 9:121957137-121957159 CCTGAGGGAGGGGTTGGGGTGGG - Intronic
1060417836 9:123445236-123445258 CCTTGGGTAGGGGTTGGGGTGGG + Intronic
1060991158 9:127850019-127850041 CCTGTGGCAGGAGTGGGGGTGGG - Intronic
1061035235 9:128109922-128109944 TCAGTGGCAGGGGTGGAGGTCGG - Intergenic
1061342138 9:129991080-129991102 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1061683056 9:132253144-132253166 GATTAGCCAGGGGTGGTGGTGGG + Intergenic
1061766373 9:132884101-132884123 CCCTCGGCCGGGGTGGGGGTCGG - Intronic
1062228506 9:135467482-135467504 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1062244787 9:135560357-135560379 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1062249330 9:135586408-135586430 CCTCTGACAGGTGTGGAGGTTGG - Intergenic
1062249941 9:135588882-135588904 CCTTGGGCTGGGGTGGAGAATGG + Intergenic
1062513634 9:136921404-136921426 CCTCGGGCAGGGGTCGGGGTAGG + Intronic
1062554679 9:137108571-137108593 CCCTAGGCAGGGGTCCAGATAGG - Exonic
1062574756 9:137200857-137200879 CCTATGGCAGGGGAGGAGGGCGG + Intronic
1062752486 9:138265845-138265867 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1203732967 Un_GL000216v2:107637-107659 ATTTAGGCAGGTGTGGTGGTGGG + Intergenic
1203574997 Un_KI270745v1:626-648 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1185464275 X:345869-345891 CCCTAGGCGGGTGTGGGGGTGGG + Intronic
1185483418 X:465065-465087 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1185504185 X:619597-619619 CCTGGGGCAGGGGTGGGGGTGGG + Intergenic
1185528626 X:799436-799458 ACTTAGGCAGGCGTGGTGGCGGG - Intergenic
1185553513 X:1002544-1002566 ACTTAGCCAGGTGTGGTGGTGGG - Intergenic
1185559035 X:1044512-1044534 AATTAGCCAGGGGTGGTGGTGGG - Intergenic
1185885558 X:3779351-3779373 CATTAGCCAGGAGTGGTGGTGGG + Intergenic
1186116982 X:6314497-6314519 CCTGAGGCTGGGGTTGTGGTGGG - Intergenic
1186653910 X:11592293-11592315 TTCCAGGCAGGGGTGGAGGTAGG - Intronic
1187176782 X:16903024-16903046 GCTTTGGCAGAGGTGGTGGTGGG + Intergenic
1187256181 X:17644623-17644645 CCTGAGCCAGTGGTGGAGATAGG + Intronic
1187649093 X:21380593-21380615 AATTAGCCAGGGGTGGTGGTGGG - Intronic
1187886440 X:23893281-23893303 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1188175410 X:26983094-26983116 AATTAGTCAGGGGTGGTGGTGGG - Intergenic
1188212877 X:27444554-27444576 CCTTATGCAGGGGAGGAGCCTGG - Intergenic
1188562936 X:31490411-31490433 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1188975486 X:36668751-36668773 CCAGAGGCTGGGGTAGAGGTGGG + Intergenic
1189284107 X:39839742-39839764 TCTTAGACAGGGCTGGAGGGAGG + Intergenic
1189330026 X:40138701-40138723 AATTAGGCAGGCGTGGTGGTGGG - Intronic
1189574023 X:42330542-42330564 CATTAGGCAGGGGTGAACCTGGG + Intergenic
1189817057 X:44834619-44834641 CCTAAGGCAGAGGTGGCAGTTGG - Intergenic
1190136534 X:47804291-47804313 CTATAGGCGGTGGTGGAGGTGGG - Intergenic
1191231233 X:58097759-58097781 AATTAGGCAGGCGTGGTGGTGGG - Intergenic
1191601369 X:63013017-63013039 CCTGAGGCATGTGTGAAGGTAGG - Intergenic
1191809743 X:65174473-65174495 CCTGGGGAAGGGGTGGATGTGGG - Intergenic
1191844071 X:65533577-65533599 CATGGGGTAGGGGTGGAGGTTGG - Intronic
1192155705 X:68744972-68744994 CCTCTGCCAGGAGTGGAGGTAGG + Intergenic
1192155865 X:68746210-68746232 GCTCGGGCAGGGGTGGGGGTGGG - Intergenic
1192743318 X:73914195-73914217 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1193029210 X:76879868-76879890 ACTTAGAAATGGGTGGAGGTTGG - Intergenic
1194483795 X:94461656-94461678 ACTTAGTCAGGGGTGGTGGTGGG + Intergenic
1195299297 X:103511352-103511374 AATTAGGCAGGTGTGGTGGTGGG + Intronic
1195318344 X:103700365-103700387 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1195669800 X:107460019-107460041 TTTGAGGCAGGGGTGGTGGTTGG + Intergenic
1196585950 X:117428200-117428222 CCTTAGGTAGGGGTGCAGTTTGG + Intergenic
1196798989 X:119525101-119525123 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1196824865 X:119733008-119733030 ACTTAGCCAGGCGTGGTGGTGGG + Intergenic
1197066492 X:122239062-122239084 CCTTATGCAGGGAAGGAGGCTGG + Intergenic
1198043614 X:132878277-132878299 CCTTATGCAGGGGTGGAGCCTGG - Intronic
1198363063 X:135914887-135914909 CCTTGTGCAAGGGTGGCGGTGGG - Intergenic
1198956582 X:142137920-142137942 CTTAAGGCAGGGGTGGGGGGCGG + Intergenic
1198958895 X:142162590-142162612 TCTTTGGCGGGGGTGGAGGGTGG + Intergenic
1199592447 X:149479973-149479995 CCTTCGGGAGGGGGGGAGCTTGG + Intergenic
1199682260 X:150234624-150234646 GATTAGGCAGGCGTAGAGGTTGG - Intergenic
1200083226 X:153589704-153589726 CATTCAGCAGGGGTGGACGTAGG - Intronic