ID: 1018899998

View in Genome Browser
Species Human (GRCh38)
Location 6:168046304-168046326
Sequence GTGGTGGTCCTGACTCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018899993_1018899998 9 Left 1018899993 6:168046272-168046294 CCCACATGCGGCTCAGGTGAGGA No data
Right 1018899998 6:168046304-168046326 GTGGTGGTCCTGACTCATGGCGG No data
1018899994_1018899998 8 Left 1018899994 6:168046273-168046295 CCACATGCGGCTCAGGTGAGGAG No data
Right 1018899998 6:168046304-168046326 GTGGTGGTCCTGACTCATGGCGG No data
1018899990_1018899998 15 Left 1018899990 6:168046266-168046288 CCTGTGCCCACATGCGGCTCAGG No data
Right 1018899998 6:168046304-168046326 GTGGTGGTCCTGACTCATGGCGG No data
1018899988_1018899998 24 Left 1018899988 6:168046257-168046279 CCAAGTAAACCTGTGCCCACATG No data
Right 1018899998 6:168046304-168046326 GTGGTGGTCCTGACTCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018899998 Original CRISPR GTGGTGGTCCTGACTCATGG CGG Intergenic
No off target data available for this crispr