ID: 1018900520

View in Genome Browser
Species Human (GRCh38)
Location 6:168049708-168049730
Sequence AAGGAGCCCAGGCCCCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018900508_1018900520 26 Left 1018900508 6:168049659-168049681 CCACAGAACCTGTGACATGGGCA No data
Right 1018900520 6:168049708-168049730 AAGGAGCCCAGGCCCCGAGGAGG No data
1018900510_1018900520 18 Left 1018900510 6:168049667-168049689 CCTGTGACATGGGCAGGCTCAGG No data
Right 1018900520 6:168049708-168049730 AAGGAGCCCAGGCCCCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018900520 Original CRISPR AAGGAGCCCAGGCCCCGAGG AGG Intergenic
No off target data available for this crispr