ID: 1018900626

View in Genome Browser
Species Human (GRCh38)
Location 6:168050094-168050116
Sequence TGCACAGAGGCCGCCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018900626_1018900634 7 Left 1018900626 6:168050094-168050116 CCTGCGGGGGCGGCCTCTGTGCA No data
Right 1018900634 6:168050124-168050146 GAAGGGTCCACAGTGGCAAAGGG No data
1018900626_1018900635 8 Left 1018900626 6:168050094-168050116 CCTGCGGGGGCGGCCTCTGTGCA No data
Right 1018900635 6:168050125-168050147 AAGGGTCCACAGTGGCAAAGGGG No data
1018900626_1018900631 0 Left 1018900626 6:168050094-168050116 CCTGCGGGGGCGGCCTCTGTGCA No data
Right 1018900631 6:168050117-168050139 GAGGCCTGAAGGGTCCACAGTGG No data
1018900626_1018900633 6 Left 1018900626 6:168050094-168050116 CCTGCGGGGGCGGCCTCTGTGCA No data
Right 1018900633 6:168050123-168050145 TGAAGGGTCCACAGTGGCAAAGG No data
1018900626_1018900630 -10 Left 1018900626 6:168050094-168050116 CCTGCGGGGGCGGCCTCTGTGCA No data
Right 1018900630 6:168050107-168050129 CCTCTGTGCAGAGGCCTGAAGGG No data
1018900626_1018900636 9 Left 1018900626 6:168050094-168050116 CCTGCGGGGGCGGCCTCTGTGCA No data
Right 1018900636 6:168050126-168050148 AGGGTCCACAGTGGCAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018900626 Original CRISPR TGCACAGAGGCCGCCCCCGC AGG (reversed) Intergenic
No off target data available for this crispr