ID: 1018902522

View in Genome Browser
Species Human (GRCh38)
Location 6:168058651-168058673
Sequence GCTTCTCCTCTAGCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018902511_1018902522 17 Left 1018902511 6:168058611-168058633 CCACCTGTTCCCCACCTGGGCAT No data
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902519_1018902522 -6 Left 1018902519 6:168058634-168058656 CCAGGAACCACTGGCTCGCTTCT No data
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902512_1018902522 14 Left 1018902512 6:168058614-168058636 CCTGTTCCCCACCTGGGCATCCA 0: 1
1: 0
2: 2
3: 31
4: 255
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902507_1018902522 24 Left 1018902507 6:168058604-168058626 CCTGAGCCCACCTGTTCCCCACC 0: 1
1: 0
2: 0
3: 57
4: 595
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902517_1018902522 3 Left 1018902517 6:168058625-168058647 CCTGGGCATCCAGGAACCACTGG No data
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902514_1018902522 8 Left 1018902514 6:168058620-168058642 CCCCACCTGGGCATCCAGGAACC 0: 1
1: 0
2: 1
3: 27
4: 293
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902515_1018902522 7 Left 1018902515 6:168058621-168058643 CCCACCTGGGCATCCAGGAACCA 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902516_1018902522 6 Left 1018902516 6:168058622-168058644 CCACCTGGGCATCCAGGAACCAC No data
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902510_1018902522 18 Left 1018902510 6:168058610-168058632 CCCACCTGTTCCCCACCTGGGCA No data
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data
1018902506_1018902522 25 Left 1018902506 6:168058603-168058625 CCCTGAGCCCACCTGTTCCCCAC No data
Right 1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018902522 Original CRISPR GCTTCTCCTCTAGCTCCTCT GGG Intronic