ID: 1018903247

View in Genome Browser
Species Human (GRCh38)
Location 6:168061608-168061630
Sequence TGGAGTGGAATTCTATAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1084
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 1022}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903247_1018903258 23 Left 1018903247 6:168061608-168061630 CCCATCTATAGAATTCCACTCCA 0: 1
1: 0
2: 6
3: 55
4: 1022
Right 1018903258 6:168061654-168061676 CGCCCTTCGACCTCAGCATCTGG 0: 1
1: 0
2: 0
3: 7
4: 104
1018903247_1018903253 -9 Left 1018903247 6:168061608-168061630 CCCATCTATAGAATTCCACTCCA 0: 1
1: 0
2: 6
3: 55
4: 1022
Right 1018903253 6:168061622-168061644 TCCACTCCAGGCAGAGCTGGGGG 0: 1
1: 0
2: 2
3: 27
4: 285
1018903247_1018903252 -10 Left 1018903247 6:168061608-168061630 CCCATCTATAGAATTCCACTCCA 0: 1
1: 0
2: 6
3: 55
4: 1022
Right 1018903252 6:168061621-168061643 TTCCACTCCAGGCAGAGCTGGGG 0: 1
1: 0
2: 2
3: 32
4: 317
1018903247_1018903261 25 Left 1018903247 6:168061608-168061630 CCCATCTATAGAATTCCACTCCA 0: 1
1: 0
2: 6
3: 55
4: 1022
Right 1018903261 6:168061656-168061678 CCCTTCGACCTCAGCATCTGGGG 0: 1
1: 0
2: 0
3: 15
4: 238
1018903247_1018903263 26 Left 1018903247 6:168061608-168061630 CCCATCTATAGAATTCCACTCCA 0: 1
1: 0
2: 6
3: 55
4: 1022
Right 1018903263 6:168061657-168061679 CCTTCGACCTCAGCATCTGGGGG 0: 1
1: 0
2: 0
3: 31
4: 216
1018903247_1018903259 24 Left 1018903247 6:168061608-168061630 CCCATCTATAGAATTCCACTCCA 0: 1
1: 0
2: 6
3: 55
4: 1022
Right 1018903259 6:168061655-168061677 GCCCTTCGACCTCAGCATCTGGG 0: 1
1: 0
2: 0
3: 6
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903247 Original CRISPR TGGAGTGGAATTCTATAGAT GGG (reversed) Intronic
906575410 1:46885036-46885058 TGGGGAGGATTTCTAGAGATGGG - Intergenic
906596566 1:47082859-47082881 TGGGGAGGATTTCTAGAGATGGG + Intronic
906724970 1:48037458-48037480 TGGAGGGGAATTCTCTAAAGAGG + Intergenic
912644455 1:111378939-111378961 TGGAGTGGAATTGTAGACAATGG - Intergenic
912861056 1:113214278-113214300 TGGGATGGAATTATATAGTTTGG - Intergenic
913514616 1:119593558-119593580 TGGAGTGGACTCGTATGGATGGG + Intergenic
915819329 1:159005229-159005251 TGTAATGGAATACTATAGACTGG - Intronic
916770923 1:167907181-167907203 TGGGCTGGAATACCATAGATGGG + Intronic
917717424 1:177752510-177752532 TGGAGTGGGATTCTACTGGTTGG - Intergenic
920278139 1:204823830-204823852 TGGAATGGAATTTGAGAGATGGG - Intergenic
921452267 1:215323269-215323291 AGGAGTGGAATTATATGGTTTGG - Intergenic
921887251 1:220319524-220319546 AGGAGTGGAATGCTATGGTTTGG + Intergenic
924037792 1:239954218-239954240 TGGACTGGAACTGTGTAGATAGG + Intergenic
1062954543 10:1531447-1531469 TGGTGTGGAATATTGTAGATTGG - Intronic
1065853460 10:29810936-29810958 TGGAGTGGAGTTGTAGACATAGG - Intergenic
1066281930 10:33926185-33926207 TGGCCTGGAATTCAGTAGATGGG + Intergenic
1066737662 10:38493749-38493771 TGGAATGGAATGGAATAGATTGG + Intergenic
1066738708 10:38501500-38501522 TGGAATGGAATTTAATGGATTGG + Intergenic
1066740806 10:38517450-38517472 TGGAGTGGAATTGAATGGAATGG + Intergenic
1066741503 10:38522708-38522730 TCGAATGGAATTCAATGGATTGG + Intergenic
1066743464 10:38580777-38580799 TGGAATGGAATGGAATAGATTGG + Intergenic
1066743513 10:38581142-38581164 TGGAATGGAATGCAATGGATTGG + Intergenic
1066743622 10:38581962-38581984 TCGAGTGGAATTGAATGGATTGG + Intergenic
1066763951 10:38785711-38785733 TGGAATGGAATGCAATAGAATGG - Intergenic
1066764709 10:38792176-38792198 TGGAATGGAATGCAATAGAATGG - Intergenic
1066764722 10:38792286-38792308 TGGAATGGAATTCAATGGAATGG - Intergenic
1066765314 10:38797311-38797333 TGGACTGGAATTCAATGGAAAGG - Intergenic
1066765631 10:38800008-38800030 TGGAGTGGAATGGTATGGAATGG - Intergenic
1066765733 10:38800908-38800930 TGGAATGGAATTGAATAGAATGG - Intergenic
1066766136 10:38804593-38804615 TGGAATGGAATTGAATGGATTGG - Intergenic
1066767550 10:38816503-38816525 TGGAATGGAATTGGATAGAACGG - Intergenic
1066767743 10:38818003-38818025 TGGAATGGAATGCAATAGAATGG - Intergenic
1066767994 10:38820258-38820280 TGGAGTGGAATTGGATGGAACGG - Intergenic
1066768748 10:38826463-38826485 TGGAATGGAATTCAATGGAATGG + Intergenic
1066769374 10:38831681-38831703 TGGAAAGGAATTCAATAGAATGG + Intergenic
1066769533 10:38833165-38833187 TGGAGTTGAATTTAATAGAATGG + Intergenic
1066770315 10:38839873-38839895 TGGAGTGGAATGGTATCGAATGG + Intergenic
1066771644 10:38851058-38851080 TGGAATGGAATTGTATGGAATGG + Intergenic
1066772342 10:38856598-38856620 TGGAATGGACTGGTATAGATCGG + Intergenic
1066773063 10:38862660-38862682 TGGAATGGAATTAAATAGAATGG + Intergenic
1066773273 10:38864494-38864516 TGGAATGGAATTGAATAGAAAGG + Intergenic
1066775396 10:38881704-38881726 TGGAATGGAATGCAATAGAACGG + Intergenic
1066775455 10:38882199-38882221 TGGAATGGAATCAAATAGATTGG + Intergenic
1066776205 10:38888494-38888516 TGGAATGGAATTCAATGGAATGG + Intergenic
1066776415 10:38890231-38890253 TCGAGTGGAATGCAATAGAATGG + Intergenic
1066776532 10:38891192-38891214 TCGAGTGGAATGCAATAGAATGG + Intergenic
1066777030 10:38895355-38895377 TGGAGTGGAATCGTAAGGATTGG + Intergenic
1066777760 10:38901311-38901333 AGGAGTGGAATTGAATAGAATGG + Intergenic
1066777872 10:38902201-38902223 TGGAATGGAATTGAATAGAATGG + Intergenic
1066778756 10:38919505-38919527 TGGAATGGAATTCAATGGAGTGG + Intergenic
1066778877 10:38920212-38920234 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1066937830 10:41859479-41859501 TGGAATGGAATGCTATGGACTGG + Intergenic
1066938660 10:41864880-41864902 TGGAGTGGAATGGAATAGAATGG + Intergenic
1066938896 10:41866392-41866414 TGGAATGGAATGGAATAGATTGG + Intergenic
1066939204 10:41868399-41868421 TGGAATGGAATGGTATAGAATGG + Intergenic
1066940956 10:41879561-41879583 TGGAATGGAATGCTATGGAATGG + Intergenic
1066941342 10:41881961-41881983 TGGAGTGGAATGCAATGGAATGG + Intergenic
1066942024 10:41886190-41886212 TGGAATGGAATTCAACAGAATGG + Intergenic
1066942668 10:41890358-41890380 TGGAATGGAATGCAATAGAATGG + Intergenic
1066943086 10:41892981-41893003 TGGAATGGAATGCTATGGAATGG + Intergenic
1066943186 10:41893611-41893633 TGGAATGGAATGCAATGGATTGG + Intergenic
1066944273 10:41900642-41900664 TGGAATGGAATGCTATGGAATGG + Intergenic
1066944571 10:41902524-41902546 TGGAATGGAATTCAATGGAATGG + Intergenic
1066945354 10:41907485-41907507 TGGAATGGAATGCAATAGAATGG + Intergenic
1066945383 10:41907660-41907682 TGGAGTGGAATGCAATGGAACGG + Intergenic
1066946188 10:41912723-41912745 TGGAATGGAATGCAATGGATTGG + Intergenic
1066970477 10:42308487-42308509 TGGAATGGAATGGTATAGAATGG - Intergenic
1066970960 10:42311974-42311996 TGGAATGGAATTGTATGGAATGG - Intergenic
1066971409 10:42315102-42315124 TGGAATGGAATGGTATAGAATGG - Intergenic
1066971646 10:42316965-42316987 TGGAATGGAATTGGATGGATTGG - Intergenic
1066971882 10:42318816-42318838 TGGAATGGAATGCAATAGAATGG - Intergenic
1069239535 10:66122983-66123005 TGGGGTGGAATTATATGGTTTGG - Intronic
1071221646 10:83474069-83474091 TGGAGTGGGAGATTATAGATAGG + Intergenic
1071226245 10:83531708-83531730 TTGAGTTGAATTGTATATATAGG - Intergenic
1071746999 10:88432760-88432782 TGGAGGGGCATTCTATGAATGGG + Intronic
1072010129 10:91295727-91295749 GCGAGTGGAATTCTAGAGTTTGG + Intergenic
1072915757 10:99536563-99536585 TGGAGAGGAATCCTTTAAATAGG + Intergenic
1074674153 10:115829059-115829081 TGGAGGGAAATTCTACAGATAGG - Intronic
1074988304 10:118677705-118677727 TGCTGTGGAATTCTCTAGAGTGG - Exonic
1076210387 10:128637211-128637233 TAGAATATAATTCTATAGATAGG + Intergenic
1076912157 10:133395986-133396008 AGCAGTGGAATCCTCTAGATGGG + Intronic
1077378928 11:2219011-2219033 TGGGGAGGAATGCTATAGTTTGG - Intergenic
1079578540 11:22033058-22033080 AGGAGTGGAAATTTATAGAAAGG - Intergenic
1081120762 11:39262815-39262837 TGGGGTGGAATGATATAGTTTGG - Intergenic
1085755146 11:79195853-79195875 AGGAGTGGAATTTTATGGTTTGG + Intronic
1087350940 11:97031093-97031115 TTGAGTGGTAATCTAAAGATGGG - Intergenic
1087930267 11:103968982-103969004 TGAAGTGGAATTAGATAAATGGG - Intronic
1092835956 12:12488460-12488482 TTGAGTGCAATTCTATAGCTGGG - Intronic
1098592550 12:72230759-72230781 TGGAGTGGAATTTTACAGTAAGG - Intronic
1098649815 12:72951491-72951513 TAGAATGGAATTATATGGATTGG - Intergenic
1099237175 12:80095571-80095593 GGGAGTGGAATTATAAAGATAGG + Intergenic
1100377403 12:94030139-94030161 TGGAGTGAAATTTTCTGGATTGG + Intergenic
1103445981 12:120995529-120995551 TGGAGTGGAATGGTATAGAGTGG - Intronic
1103445993 12:120995613-120995635 TGGAGTGGAATGGTATGGAGTGG - Intronic
1103446010 12:120995723-120995745 TGGAGTGGAATGGTATAGGGTGG - Intronic
1105231122 13:18496767-18496789 TGTTGTGGAATTCTATATATGGG + Intergenic
1106073232 13:26434455-26434477 TGGAGTAGAATGATATAGAGGGG + Intergenic
1108740878 13:53337410-53337432 TGGATTGGAAATATATATATTGG - Intergenic
1109390276 13:61683321-61683343 TGGGGTGGAATAATATAGTTTGG + Intergenic
1112620855 13:101052405-101052427 GGAAGTGGCATTCTATACATGGG - Intergenic
1113997038 14:16097247-16097269 TGGAGTGGAATGCAATGGAGTGG - Intergenic
1113997316 14:16099079-16099101 TGGAGTGGAATGCAATGGAATGG - Intergenic
1113997372 14:16099489-16099511 TGGAGTGGAATGGAATGGATTGG - Intergenic
1113997388 14:16099589-16099611 TGGAGTGGAATGCAATGGAATGG - Intergenic
1113997664 14:16101545-16101567 TGGAGTGGAATGCAATGGAATGG - Intergenic
1113998085 14:16104513-16104535 TGGAGTGGAATGGAATGGATTGG - Intergenic
1114081468 14:19204390-19204412 TGGGGTGGAATGATATAGTTTGG + Intergenic
1115459851 14:33648535-33648557 TGACTTGGAATTCTATAAATTGG - Intronic
1117427794 14:55619810-55619832 TGGAGTGGAATGTTATGGTTTGG - Intronic
1117632838 14:57711017-57711039 TAGAGTGGAATTATATGGTTTGG + Intronic
1117669855 14:58095723-58095745 GGGAGTTGCACTCTATAGATTGG - Intronic
1121623444 14:95366713-95366735 TGGACTGGAATGGAATAGATTGG + Intergenic
1122154042 14:99739620-99739642 TCACGTGGCATTCTATAGATGGG - Intronic
1202872770 14_GL000225v1_random:178669-178691 TGGAGTGGAAATCTTTATACTGG - Intergenic
1202874174 14_GL000225v1_random:192819-192841 TGGAGTTGAATGCAATAGAATGG + Intergenic
1202874219 14_GL000225v1_random:193174-193196 TGGAGTGGAATGGAATAGAATGG + Intergenic
1202874345 14_GL000225v1_random:194080-194102 TGGAGTGGAATGGAATGGATTGG + Intergenic
1202875055 14_GL000225v1_random:199401-199423 TGGAGTCGAATTGAATAGAGTGG + Intergenic
1123228913 15:17081219-17081241 TGGAGTGGAATGTCATAGAGTGG + Intergenic
1123229067 15:17082251-17082273 TGGAGTGGAATGGAATGGATTGG + Intergenic
1123229240 15:17083378-17083400 TGGAATGGAATTTAATAGAATGG + Intergenic
1129350356 15:74952423-74952445 TGCAGTGGATTTCTCTTGATGGG - Intergenic
1130396409 15:83506365-83506387 TGAAGTGGGATCCTATATATTGG + Intronic
1131032513 15:89198038-89198060 GGGAGTGGCAGTTTATAGATAGG + Exonic
1131675149 15:94663610-94663632 TAGAGTGGAATTCAAGAGAAAGG + Intergenic
1133131886 16:3681241-3681263 TGGAGAGGAAGTCTTTAGAAAGG - Intronic
1136906478 16:34097852-34097874 TGGAATGGAATGGTATAGAATGG - Intergenic
1136906503 16:34098027-34098049 TGGAGTGGAATGGTTTAGAGTGG - Intergenic
1138316798 16:56077193-56077215 TGGACAGGATTTCTATAAATAGG + Intergenic
1139038020 16:62971317-62971339 TTGCTTGGAATTCTATAAATTGG + Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144465868 17:15496794-15496816 TGGATTTTTATTCTATAGATGGG + Intronic
1145328616 17:21852094-21852116 TGGAATGGAATTGAATAGAATGG + Intergenic
1145328634 17:21852264-21852286 TGGAATGGAATTGAATAGAATGG + Intergenic
1145329432 17:21858801-21858823 TGGAGTGGAATGGAATAGAATGG + Intergenic
1145329776 17:21861691-21861713 TGGAATGGAATGCAATGGATTGG + Intergenic
1145330053 17:21863965-21863987 TTGAGTGGAATGCAATAGAATGG + Intergenic
1145330080 17:21864190-21864212 TGGAGTGGAATGGAATAGAATGG + Intergenic
1145331156 17:21873395-21873417 TGGAGTGGAATGCAATGGAATGG + Intergenic
1145331688 17:21877695-21877717 TGGAGTGGAATGGAATAGAATGG + Intergenic
1145332743 17:21886518-21886540 TGGAGTGGAATGCAATGGAATGG + Intergenic
1145332749 17:21886568-21886590 TGGAGTGGAATGCAATGGAATGG + Intergenic
1145333252 17:21890710-21890732 TGGAATGGAATGCAATGGATTGG + Intergenic
1145333695 17:21894351-21894373 TGGAGTGGAATCAAATAGAATGG + Intergenic
1145333982 17:21896789-21896811 TGGAGTGGAATCAAATAGAATGG + Intergenic
1145335073 17:21905562-21905584 TGGAATGGAATTCAATGGAAAGG + Intergenic
1145335266 17:21907160-21907182 TGGAATGGAATGCAATAGAATGG + Intergenic
1145335779 17:21911238-21911260 TGGAGTGGAATTGAATGGAATGG + Intergenic
1145337128 17:21922532-21922554 TGGAGTGGAATGGTATGGAATGG + Intergenic
1145337269 17:21923596-21923618 TGGAATGGAATTGAATAGAATGG + Intergenic
1145337725 17:21927130-21927152 TGGAGTGGAATGGTATTGAATGG + Intergenic
1145337764 17:21927455-21927477 TGGAATGGAATTGGATAGAATGG + Intergenic
1145337898 17:21928479-21928501 TGGAGTGGCATTGAATAGAATGG + Intergenic
1145339086 17:21938389-21938411 TGGAATGGAATGCAATAGAATGG + Intergenic
1145340225 17:21947915-21947937 TGCAGTGGAATTGAATAGAATGG + Intergenic
1145340381 17:21949266-21949288 TGGAGTGGAATGGAATAGAATGG + Intergenic
1145340388 17:21949331-21949353 TAGAGTGGAATTCAATGGAATGG + Intergenic
1145341439 17:21958206-21958228 TGGAATGGAATTGAATGGATTGG + Intergenic
1145341731 17:21960652-21960674 TGGAATGGAATCCAATGGATTGG + Intergenic
1145341733 17:21960667-21960689 TGGATTGGAATTGAATAGAATGG + Intergenic
1145341799 17:21961261-21961283 TGGAATGGAATGCAATAGAATGG + Intergenic
1145342775 17:21969349-21969371 TGGAATGGAATTCAATGGAATGG + Intergenic
1145342833 17:21969729-21969751 TGGAGTGGAATGCAATTGAATGG + Intergenic
1145343269 17:21972465-21972487 TGGATTGGAATGCCATAGAGTGG + Intergenic
1145343392 17:21973280-21973302 TGGAATGGAATTCAATAGAATGG + Intergenic
1145343402 17:21973360-21973382 TGGAATGGAATTCAATGGAATGG + Intergenic
1145343769 17:21975657-21975679 TGGAATGGAATTCAATAGCATGG + Intergenic
1145344301 17:21979211-21979233 TGGAATGGAATTCAATGGAATGG + Intergenic
1145344514 17:21980436-21980458 TGGAATGGAATTCAATAGAATGG + Intergenic
1145344757 17:21982206-21982228 TGGAGTGGAATGCAATGGAATGG + Intergenic
1145344971 17:21983591-21983613 TGGAATGGAATTCAATTGAATGG + Intergenic
1145345133 17:21985199-21985221 TGGAATGGAATGGAATAGATTGG + Intergenic
1145345157 17:21985329-21985351 TGGAATGGAATGCAATAGAATGG + Intergenic
1145345295 17:21986179-21986201 TGGAATGGAATGCAATAGAATGG + Intergenic
1145345319 17:21986339-21986361 TGGAATGGAATGCAATAGAATGG + Intergenic
1145345513 17:21987641-21987663 TGGAATGGAATTGTATGGAATGG + Intergenic
1145345788 17:21989651-21989673 TGGAATGGAATGGAATAGATTGG + Intergenic
1145345808 17:21989776-21989798 TGGAATGGAATGCAATAGAATGG + Intergenic
1145346067 17:21991392-21991414 TGGAATGGAATGGAATAGATTGG + Intergenic
1145346153 17:21991977-21991999 TGGAATGGAATTGTATGGAATGG + Intergenic
1145697568 17:26801213-26801235 TGGAATGGACTTAAATAGATTGG + Intergenic
1145698544 17:26809597-26809619 TGGAATGGAATTGAATAGAATGG + Intergenic
1145698605 17:26810192-26810214 TGGAATGGAATTGAATAGACTGG + Intergenic
1145699023 17:26813650-26813672 TGGATTGGAATTGAATAGAGTGG + Intergenic
1145699676 17:26819173-26819195 TGGAATGGAATACGATAGAATGG + Intergenic
1145699707 17:26819449-26819471 TGGAATGGAATTGGATGGATTGG + Intergenic
1145699928 17:26821536-26821558 TGGAGTGGAATGCAATGGAATGG + Intergenic
1145700131 17:26823169-26823191 TGGAATGGAATGCAATAGAATGG + Intergenic
1145700589 17:26826747-26826769 TGGAATGGAATTGAATAGAATGG + Intergenic
1145702198 17:26840078-26840100 TGGAATGGAATTGAATAGAACGG + Intergenic
1145702439 17:26842204-26842226 TGGAATGGAATTGAATAGAATGG + Intergenic
1145703175 17:26848592-26848614 TTGAATGGAATTCAATAGAATGG + Intergenic
1145703770 17:26853469-26853491 TGGAGTGGAATGGAATAGAAGGG + Intergenic
1145704359 17:26858399-26858421 TAGAATGGAATTCAATAGAATGG + Intergenic
1145704560 17:26860456-26860478 TGGATTGGAATTCAATGGAATGG + Intergenic
1145704705 17:26861630-26861652 TGGAGTGGAATACAATGGAATGG + Intergenic
1145704888 17:26863095-26863117 TGGAATGGAATTCAATGGAATGG + Intergenic
1145705076 17:26864620-26864642 TGGAATGGAATGCAATAGAATGG + Intergenic
1145706051 17:26872436-26872458 TGGAATGGAATTGAATGGATTGG + Intergenic
1145706418 17:26875475-26875497 TGGAGTGGAATCGAATGGATTGG + Intergenic
1145706626 17:26877187-26877209 TGGAATGGAATTGAATAGAATGG + Intergenic
1145706908 17:26879337-26879359 TGGAATGGAATGCAATGGATTGG + Intergenic
1145706996 17:26879879-26879901 TGGAGTGGAATGGAATAGAGTGG + Intergenic
1145707552 17:26936697-26936719 TGGAATGGAATTCAATGGAGTGG + Intergenic
1145708077 17:26940235-26940257 TGGAATGGAATTCAATGGAGTGG + Intergenic
1145708138 17:26940652-26940674 TGGAGTGGAAATGTATAGAATGG + Intergenic
1146078922 17:29759623-29759645 TGAATTTGACTTCTATAGATAGG + Intronic
1147763347 17:42815731-42815753 GGGATTGGAATTCTAGAGCTTGG - Intronic
1148916986 17:50989940-50989962 TGGAATGGAATTCTATAACAGGG - Intronic
1203174850 17_KI270729v1_random:1526-1548 TGGAATGGAATGAAATAGATTGG - Intergenic
1203175210 17_KI270729v1_random:4044-4066 TGGAATGGAATTGTATGGAATGG - Intergenic
1203176124 17_KI270729v1_random:20775-20797 TGGAATGGAATGCCATAGAATGG + Intergenic
1203176976 17_KI270729v1_random:26079-26101 TGGAATGGAATTTAATAGAATGG + Intergenic
1203177032 17_KI270729v1_random:26519-26541 TGGAATGTAATACAATAGATGGG + Intergenic
1203177052 17_KI270729v1_random:26629-26651 TGGAATGGAATACAATAGATGGG + Intergenic
1203177079 17_KI270729v1_random:26804-26826 TGGAATGGAATACAATAGATGGG + Intergenic
1203178653 17_KI270729v1_random:38949-38971 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203178947 17_KI270729v1_random:41186-41208 TGGAATGGAATGGTATAGAATGG + Intergenic
1203179518 17_KI270729v1_random:45665-45687 TGGAATGGAATGGTATAGAGTGG + Intergenic
1203179617 17_KI270729v1_random:46408-46430 TGAAATGGAATTCTATGGAATGG + Intergenic
1203180027 17_KI270729v1_random:49426-49448 TGGAATGGACTTGAATAGATTGG + Intergenic
1203180362 17_KI270729v1_random:51849-51871 TGGATTGGAATACAATAGAAAGG + Intergenic
1203180602 17_KI270729v1_random:53701-53723 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203180808 17_KI270729v1_random:55269-55291 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203181049 17_KI270729v1_random:57069-57091 TGGAATGGAATGCAATGGATTGG + Intergenic
1203193919 17_KI270729v1_random:214378-214400 TGGAATGGAGTTCAATAGAATGG + Intergenic
1203194026 17_KI270729v1_random:215212-215234 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203194958 17_KI270729v1_random:223146-223168 TGGAGTGGAATTCAGTGGAATGG + Intergenic
1203196796 17_KI270729v1_random:239691-239713 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203197042 17_KI270729v1_random:241813-241835 TGGAATGGAATCACATAGATTGG + Intergenic
1203197213 17_KI270729v1_random:243220-243242 TGGAGTGGAATTGAATTGAATGG + Intergenic
1203197449 17_KI270729v1_random:245178-245200 TGGAGTGGAATTGAATGGAAAGG + Intergenic
1203197859 17_KI270729v1_random:248720-248742 TGGAATGGAATTCAATGGAATGG + Intergenic
1203198261 17_KI270729v1_random:252061-252083 TGGAATGGAATTGTATGGAATGG + Intergenic
1203199461 17_KI270729v1_random:262258-262280 TGGAATGCAATTCTATTGAATGG + Intergenic
1203200932 17_KI270729v1_random:274659-274681 TGGAATGGAATTGAATAGAATGG + Intergenic
1203203283 17_KI270730v1_random:13808-13830 TGGAATGGAGTTCAATAGAATGG + Intergenic
1203203389 17_KI270730v1_random:14637-14659 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203204312 17_KI270730v1_random:22537-22559 TGGAGTGGAATTCAGTGGAATGG + Intergenic
1203206401 17_KI270730v1_random:40457-40479 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203206648 17_KI270730v1_random:42584-42606 TGGAATGGAATCACATAGATTGG + Intergenic
1203206819 17_KI270730v1_random:43991-44013 TGGAGTGGAATTGAATTGAATGG + Intergenic
1203207054 17_KI270730v1_random:45949-45971 TGGAGTGGAATTGAATGGAAAGG + Intergenic
1203207463 17_KI270730v1_random:49474-49496 TGGAATGGAATTCAATGGAATGG + Intergenic
1203207865 17_KI270730v1_random:52815-52837 TGGAATGGAATTGTATGGAATGG + Intergenic
1203209061 17_KI270730v1_random:62998-63020 TGGAATGCAATTCTATTGAATGG + Intergenic
1203210527 17_KI270730v1_random:75360-75382 TGGAATGGAATTGAATAGAATGG + Intergenic
1203211335 17_KI270730v1_random:81743-81765 TGGAATGGAATTCAATGGAGTGG + Intergenic
1203211573 17_KI270730v1_random:83407-83429 TGGAGTGGAATTGTGTGGAATGG + Intergenic
1203211846 17_KI270730v1_random:85403-85425 TGGAATGGAATACAATAGAATGG + Intergenic
1203211887 17_KI270730v1_random:85618-85640 TGGAATGGAATACTATGGAATGG + Intergenic
1203212161 17_KI270730v1_random:87564-87586 TGGAGTGGAAATATGTAGAATGG + Intergenic
1203212249 17_KI270730v1_random:88249-88271 TGGAATGGAATTCAATGGAGTGG + Intergenic
1203212328 17_KI270730v1_random:90609-90631 TGGAGTGGAATGGTGTAGAATGG + Intergenic
1203212711 17_KI270730v1_random:93195-93217 TGGAATGGAATTCAATAGAGTGG + Intergenic
1203212773 17_KI270730v1_random:95632-95654 TGGAATGGAATTCAATGGAGTGG + Intergenic
1203213194 17_KI270730v1_random:98555-98577 TGGAATGGAATTCAATGGATTGG + Intergenic
1203214125 17_KI270730v1_random:106712-106734 TGGAGTGGAAATGTGTAGAATGG + Intergenic
1203214282 17_KI270730v1_random:108057-108079 TGGAGTGGAAAGCAATAGAGTGG + Intergenic
1203214437 17_KI270730v1_random:109039-109061 TGGAGTGGAATTGAGTAGAATGG + Intergenic
1203214471 17_KI270730v1_random:109254-109276 TGGAATGGAATTCAATGGAGTGG + Intergenic
1154522330 18:15243421-15243443 TGTTCTGGAATTCTATATATGGG - Intergenic
1155563501 18:27107022-27107044 TGGAGTGGGTTTCCACAGATGGG + Intronic
1156611172 18:38726436-38726458 TGAAGTAGTTTTCTATAGATGGG + Intergenic
1156754573 18:40506332-40506354 GGGAGGGGAACTCTATTGATTGG - Intergenic
1159493523 18:69169607-69169629 CAGAGTGCAATTCTATAAATTGG - Intergenic
925487990 2:4357576-4357598 CAGTGTGGAATTCTAGAGATAGG + Intergenic
930162860 2:48176121-48176143 AGGAGTGGAATGCTATGGTTTGG - Intergenic
930280705 2:49366338-49366360 TTGATTGGAATTGCATAGATAGG - Intergenic
930427733 2:51233507-51233529 TGGGGTGGAATGATATAGTTTGG - Intergenic
930962565 2:57278440-57278462 GTGAGTGGAATACTATAGTTTGG + Intergenic
931615218 2:64148893-64148915 AGAAGTGGAATTATATAGAAAGG + Intergenic
933639772 2:84747102-84747124 AGGAGTGGAATAATATAGTTTGG - Intronic
934192361 2:89811474-89811496 TGGAGTGGACTTGAATAGAATGG - Intergenic
934192466 2:89812277-89812299 TGGAGTGGAATTCAATGGAATGG - Intergenic
934192726 2:89814476-89814498 TGGACTGGAATTCAATGGAGTGG - Intergenic
934193820 2:89823144-89823166 TGGAATGGAATGCAATTGATTGG - Intergenic
934194409 2:89827649-89827671 TGGAGTGGAATGGCATGGATTGG - Intergenic
934194799 2:89830198-89830220 TGGAATGGAATTCAATGGAATGG - Intergenic
934195453 2:89834492-89834514 TGGAATGGAATTCAATGGAATGG - Intergenic
934195486 2:89834752-89834774 TGGAATGGAATTCAATGGAAAGG - Intergenic
934195519 2:89834987-89835009 TGGAGTGGAATGGTATATAATGG - Intergenic
934195750 2:89836437-89836459 GGGAATGGAATTGTATGGATTGG + Intergenic
934195852 2:89837072-89837094 TGGAATGGAATTCAATAGAATGG + Intergenic
934196460 2:89841058-89841080 TGGAATGGAATGCAATAGAATGG + Intergenic
938132560 2:128730318-128730340 TGGGGTGGGATTTTATAGAGGGG + Intergenic
939545213 2:143543489-143543511 TGGAGTGGCAACCTATAGAATGG - Intronic
942411697 2:175716271-175716293 TGGTGAGGAATTCTAGACATCGG - Intergenic
944250366 2:197574974-197574996 TGGGGTGGAATGATATAGTTTGG + Intronic
947104345 2:226653005-226653027 TGGAGTGGCATTCCTTATATAGG - Intergenic
1168728955 20:60708-60730 TGGAGTGGAATACAATGGAATGG - Intergenic
1168728977 20:60833-60855 TGGAGTGGAATTTAATGGAATGG - Intergenic
1168728980 20:60853-60875 TGGAGTGGAATTTAATGGAATGG - Intergenic
1168729442 20:64328-64350 TGGAGTGGAATGGTATGGAGTGG - Intergenic
1168729601 20:65245-65267 TGGAGTGGAATGGAATAGAATGG - Intergenic
1171238922 20:23549510-23549532 TGGAGTGGAATGACATAGAATGG - Intergenic
1171245089 20:23604319-23604341 TGGAGTGGAATTAAATAGAATGG - Intronic
1171741287 20:28897515-28897537 TGGAATGGAATTCAATGGAACGG - Intergenic
1171741351 20:28897962-28897984 TGGAGTGGAATGGAATGGATTGG - Intergenic
1171914348 20:31051967-31051989 TGGAGTGGAATTGAATGGAATGG + Intergenic
1171914616 20:31053722-31053744 TGGAGTGGAATTTAATGGAATGG + Intergenic
1171915030 20:31056346-31056368 TGGAGTGGAATTGAATGGAATGG + Intergenic
1171915324 20:31058234-31058256 TGGAATGGAATGGTATAGAATGG + Intergenic
1171915487 20:31059289-31059311 TGGAGTGGAATGCAATGGAATGG + Intergenic
1171915921 20:31062158-31062180 TGGAATGGAATGGTATAGAATGG + Intergenic
1171916972 20:31068818-31068840 TGAAGTGGAATGGTATAGAATGG + Intergenic
1171917187 20:31070165-31070187 TGGAATGGAATGCAATGGATTGG + Intergenic
1171917547 20:31072383-31072405 TGGAGTGGAATGGAATAGAATGG + Intergenic
1171917734 20:31073608-31073630 TGGAATGGAATTCAATGGAATGG + Intergenic
1171919104 20:31083719-31083741 TGGAATGGAATTCAATGGAATGG + Intergenic
1171919472 20:31086836-31086858 TGGAGTGGAATTGAATGGAATGG + Intergenic
1171921702 20:31104102-31104124 TGGAGTGGAATGTTATGGAATGG + Intergenic
1171921796 20:31104907-31104929 TGGAATGGAATTGAATAGAAAGG + Intergenic
1171922006 20:31106601-31106623 TGGAATGGAATGCTATGGAATGG + Intergenic
1171922753 20:31164205-31164227 TGGAGTGGAATGGTATGGAATGG + Intergenic
1171922975 20:31165939-31165961 TGGAATGGAATGGAATAGATTGG + Intergenic
1171923751 20:31171945-31171967 TGGAATGGAATGCAATAGAATGG + Intergenic
1171924346 20:31176738-31176760 TGGAATGGAATCGAATAGATTGG + Intergenic
1171925368 20:31184727-31184749 TGGAGTGGAATTTAATGGAATGG + Intergenic
1171925762 20:31187215-31187237 TGGAGTGGAATGCAATGGAATGG + Intergenic
1171926228 20:31190969-31190991 TGGAGTGGAATACAATGGAAAGG + Intergenic
1171927604 20:31201868-31201890 TGGAATGGAATTCAATGGAATGG + Intergenic
1171927973 20:31204995-31205017 TGGAGTGGAATTGAATGGAATGG + Intergenic
1171929016 20:31213081-31213103 TGGAATGGAATGCTATGGAATGG + Intergenic
1171930205 20:31222257-31222279 TGGAGTGGAATGTTATGGAATGG + Intergenic
1171930297 20:31223052-31223074 TGGAATGGAATTGAATAGAAAGG + Intergenic
1171930504 20:31224742-31224764 TGGAATGGAATGCTATGGAATGG + Intergenic
1171930899 20:31228245-31228267 TGGAATGGAATTGAATAGAACGG + Intergenic
1171931215 20:31230778-31230800 TGGAATGGAATTCAATTGAATGG + Intergenic
1171931439 20:31232643-31232665 TGGAGTGGAATGGAATAGAATGG + Intergenic
1171931492 20:31233128-31233150 TGGAATGGAATCCCATAGATTGG + Intergenic
1171931735 20:31235001-31235023 TGGAATGGAATGCAATAGAATGG + Intergenic
1173413440 20:42836086-42836108 TGGAGTCAAATTCTAGAGCTAGG - Intronic
1174021933 20:47537370-47537392 TGGAGTGTTTTTCTATAGAAAGG + Intronic
1176321203 21:5327713-5327735 TGGAGTGGAATGGTATGGAATGG + Intergenic
1176321464 21:5329399-5329421 TGGAGTGGAATTGTGTGGAGTGG + Intergenic
1176478588 21:7257734-7257756 TGGAGTGGAATGGTATGGAATGG + Intergenic
1176478736 21:7258653-7258675 TGGAGTGGAATTGAATGGAAAGG + Intergenic
1176479123 21:7261197-7261219 TGGAGTGGAATTGTGTGGAGTGG + Intergenic
1176525686 21:7916229-7916251 TGGAATGGAATTAAATGGATTGG - Intergenic
1176525834 21:7917500-7917522 TGGAGTGGAATGGTATGGACTGG - Intergenic
1176526323 21:7921574-7921596 TGGAATGGACTTAAATAGATTGG - Intergenic
1176526650 21:7924366-7924388 TGGAATGGAATTGAATAGAATGG - Intergenic
1176527501 21:7931514-7931536 TGGAATGGAATTCAATGGAAAGG - Intergenic
1176527664 21:7932972-7932994 TGGAATGGAATGCAATAGAATGG - Intergenic
1176529074 21:7944176-7944198 TGGAATGGAATGCAATAGAATGG - Intergenic
1176529197 21:7945055-7945077 TGGAATGGAATTGAATAGAATGG - Intergenic
1176529245 21:7945395-7945417 TGGAGTGGAATGGTATGGAATGG - Intergenic
1176529280 21:7945650-7945672 TGGACTGGAATTCAATGGAGTGG - Intergenic
1176529337 21:7946050-7946072 TGGAGTGGAATAGAATAGAATGG - Intergenic
1176529449 21:7946834-7946856 TGGAGTGGAATGAAATGGATTGG - Intergenic
1176529588 21:7947766-7947788 TGGAATGGAATTCAATGGAAGGG - Intergenic
1176529720 21:7948705-7948727 TGGAGTGGAATGGAATAGAATGG - Intergenic
1176529810 21:7949354-7949376 TGGAGTGGAATGGAATAGAATGG - Intergenic
1176529884 21:7949889-7949911 TGGAGTGGAATGGAATAGAATGG - Intergenic
1176530338 21:7953148-7953170 TGGAGTGGAATGGAATAGAAGGG - Intergenic
1176530390 21:7953463-7953485 TGGAGTGGAATTGAATGGAATGG - Intergenic
1176746003 21:10653203-10653225 TGGACTCGAATTCAATAGAATGG - Intergenic
1176746611 21:10657807-10657829 TCGAATGGAATTCTATAGAATGG - Intergenic
1176747402 21:10663925-10663947 TGGAATGGAATGCAATAGAATGG - Intergenic
1176748397 21:10671671-10671693 TGGAGTGGAATTCAATGGATTGG - Intergenic
1176748409 21:10671746-10671768 TGGAGTGGAATTCAATGGATTGG - Intergenic
1176748602 21:10673170-10673192 TGGAGTGGAATGGAATAGAATGG - Intergenic
1176751986 21:10698361-10698383 TGGAATGGAATGCTATGGATTGG - Intergenic
1176752415 21:10701422-10701444 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176752735 21:10703682-10703704 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176753041 21:10705725-10705747 TGGAGTGGAATTGAATGGAATGG - Intergenic
1176753334 21:10707670-10707692 TGGAGTGGAATGCAATAGACTGG - Intergenic
1176753590 21:10709384-10709406 TGGAGTGGAATAGAATAGAATGG - Intergenic
1176753826 21:10710992-10711014 TGGAGTGGAAAGGAATAGATTGG - Intergenic
1176753915 21:10711607-10711629 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176754124 21:10713100-10713122 TGGAGTGGAATGCAATAGAGTGG - Intergenic
1176754245 21:10713970-10713992 TGGAGTGGAATGGAATGGATTGG - Intergenic
1176754326 21:10714554-10714576 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176754370 21:10714844-10714866 TGGAATGGAATTGAATGGATGGG - Intergenic
1176754751 21:10717576-10717598 TGGAGTGGAATGCAATGGAAAGG - Intergenic
1176754963 21:10719055-10719077 TGGAATGGAATTCAATGGAGTGG - Intergenic
1176755122 21:10720200-10720222 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176755264 21:10721143-10721165 AGGAGTTGAATGCTATAGAATGG - Intergenic
1176755360 21:10721816-10721838 TGGAGAGGAATTCAATGGAATGG - Intergenic
1176755417 21:10722180-10722202 TGGAGTGGAATCTTATGGAATGG - Intergenic
1176755749 21:10724414-10724436 TGGAGTGGAATTAAATAGAATGG - Intergenic
1176755764 21:10724528-10724550 TGGAGTGGAATTGAATGGAGGGG - Intergenic
1176755886 21:10725370-10725392 TGGAGTGGAATGGTATGGAATGG - Intergenic
1176755949 21:10725784-10725806 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176756109 21:10726854-10726876 TGGGGTGGAATTGTATTGAATGG - Intergenic
1176756142 21:10727079-10727101 TGGAGTGGAATTGAATGGAATGG - Intergenic
1176756204 21:10727478-10727500 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176756620 21:10730487-10730509 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176756666 21:10730777-10730799 TGGAGTGGAATGGAATGGATTGG - Intergenic
1176756823 21:10731757-10731779 TGGAATGGAATACTATGGAACGG - Intergenic
1176756829 21:10731792-10731814 TGGAGTGGAATTGAATGGAGTGG - Intergenic
1176757298 21:10734992-10735014 TGGAATGGAATTGAATGGATTGG - Intergenic
1176757361 21:10735447-10735469 TGGAGTGGAATGCAATGGAATGG - Intergenic
1176757418 21:10735847-10735869 TGGAATGGAATGCAATAAATTGG - Intergenic
1176757504 21:10736452-10736474 TGGAGTGGAAAGCAATAGAATGG - Intergenic
1176775099 21:13125024-13125046 TGTTGTGGAATTCTATATATGGG + Intergenic
1177164077 21:17580319-17580341 TGGCCTGGAATTCTTTAAATTGG - Intronic
1180152863 21:45960831-45960853 AGGAGTGGAATGATATAGTTTGG - Intergenic
1180283233 22:10721776-10721798 TGGAATGGAATGCAATAGAATGG - Intergenic
1180283424 22:10723120-10723142 TGGAATGGAATTGAATAGACTGG - Intergenic
1180283938 22:10726914-10726936 TGGAGTTGAATGCAATAGAATGG - Intergenic
1180285334 22:10740831-10740853 TGGAGTGGAAATCTTTATACTGG + Intergenic
1180499306 22:15918296-15918318 TGGGGTGGAATGATATAGTTTGG - Intergenic
1180530728 22:16347942-16347964 TGGAGTGGAATTTAATTGAATGG + Intergenic
1180531465 22:16353348-16353370 TGGAATGGAATACAATAGAATGG + Intergenic
1180532335 22:16359580-16359602 TGGAATGGAATTCAATGGAATGG + Intergenic
1180532721 22:16362359-16362381 TGGAGTGGAATGGAATCGATTGG + Intergenic
1183803176 22:40185525-40185547 TTGAGTGGAACCCTACAGATTGG + Intronic
1183883189 22:40854540-40854562 TAAAGTGGAATTCTCTACATAGG + Intronic
1203291463 22_KI270735v1_random:42667-42689 TGGAATGGAATTCAATGGAGTGG - Intergenic
1203291728 22_KI270736v1_random:1548-1570 TGGAATGGAATTCAATGGAATGG + Intergenic
1203291819 22_KI270736v1_random:2127-2149 TGGAGTGGAATGCAATGGATTGG + Intergenic
1203291843 22_KI270736v1_random:2267-2289 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203291858 22_KI270736v1_random:2387-2409 TGGAATGGAATGCAATGGATTGG + Intergenic
1203296591 22_KI270736v1_random:48081-48103 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203296927 22_KI270736v1_random:50000-50022 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1203297070 22_KI270736v1_random:50844-50866 TGGAGTGGAATGGTATGGAATGG + Intergenic
1203297210 22_KI270736v1_random:51733-51755 TGGAGTGGAATGGAATAGGTTGG + Intergenic
1203297267 22_KI270736v1_random:52051-52073 TGGAGTGGAATGGAATGGATAGG + Intergenic
1203297355 22_KI270736v1_random:52671-52693 TGGAGTGGAGTTTAATAGAATGG + Intergenic
1203297383 22_KI270736v1_random:52846-52868 TGGAGTGGAGTGGAATAGATTGG + Intergenic
1203297807 22_KI270736v1_random:55500-55522 TGGACTGGAATGCAATAGAGTGG + Intergenic
1203297809 22_KI270736v1_random:55520-55542 TGGAGTGGAATGCAATAGATTGG + Intergenic
1203297911 22_KI270736v1_random:56177-56199 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203297936 22_KI270736v1_random:56372-56394 TGGAATGGAATTCAATGGAAAGG + Intergenic
1203298053 22_KI270736v1_random:57279-57301 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203298186 22_KI270736v1_random:58611-58633 TGGAGTGGAATGCAATGGAGTGG + Intergenic
1203298286 22_KI270736v1_random:59286-59308 TGGAATGGAATGCTATGGAGTGG + Intergenic
1203298315 22_KI270736v1_random:59506-59528 TGGAGTGGAATTGAATTGAGTGG + Intergenic
1203298906 22_KI270736v1_random:63362-63384 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203299130 22_KI270736v1_random:64764-64786 TGGAATGGAATGCAATGGATGGG + Intergenic
1203299583 22_KI270736v1_random:67653-67675 TGGAGTGGAGTTCAATGGAGTGG + Intergenic
1203299882 22_KI270736v1_random:69605-69627 TGTAGTGGAATGGAATAGATAGG + Intergenic
1203300323 22_KI270736v1_random:72634-72656 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203300390 22_KI270736v1_random:73083-73105 TGGAGTGGATTGCAATAGAACGG + Intergenic
1203300495 22_KI270736v1_random:73712-73734 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1203300738 22_KI270736v1_random:75319-75341 TGGAGTAGAATTGAATCGATTGG + Intergenic
1203300859 22_KI270736v1_random:76109-76131 TGGAATGGAATTCAATGGAATGG + Intergenic
1203301054 22_KI270736v1_random:77407-77429 TGGAGTGGAATTGAATAGATTGG + Intergenic
1203301342 22_KI270736v1_random:79254-79276 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203301717 22_KI270736v1_random:81796-81818 TGGAGTGGAATGGAATGGATAGG + Intergenic
1203301862 22_KI270736v1_random:82695-82717 TGGAATGGAATGCAATAGAGTGG + Intergenic
1203301876 22_KI270736v1_random:82770-82792 TGGAGTGGAATGCAATGGAAGGG + Intergenic
1203301914 22_KI270736v1_random:83005-83027 TGGAATGGAATTCAATGGAATGG + Intergenic
1203302049 22_KI270736v1_random:83886-83908 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203302243 22_KI270736v1_random:85251-85273 TGGAGTGGAATGGTAAAGAATGG + Intergenic
1203302415 22_KI270736v1_random:86315-86337 TGGAGTGGAATTCAGTGGAATGG + Intergenic
1203302617 22_KI270736v1_random:87650-87672 TGGAGTGGAATGCAATGAATTGG + Intergenic
1203302950 22_KI270736v1_random:89820-89842 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203303044 22_KI270736v1_random:90497-90519 TGGAGTGGAGTGCAATGGATTGG + Intergenic
1203303208 22_KI270736v1_random:91572-91594 TGGAGTGGAATGTAATAGAATGG + Intergenic
1203303288 22_KI270736v1_random:92111-92133 TGGAATGGAATGGAATAGATTGG + Intergenic
1203303303 22_KI270736v1_random:92225-92247 TGGAGTGGAATTGAGTAGAATGG + Intergenic
1203303374 22_KI270736v1_random:92690-92712 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203303840 22_KI270736v1_random:95611-95633 TGGAATGGAATTCAATGGAATGG + Intergenic
1203303875 22_KI270736v1_random:95830-95852 TGGAGTGGAATGCAATGGAACGG + Intergenic
1203303928 22_KI270736v1_random:96189-96211 TGGAGTGGAGTTGAATGGATTGG + Intergenic
1203303956 22_KI270736v1_random:96374-96396 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203304393 22_KI270736v1_random:99103-99125 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203304451 22_KI270736v1_random:99455-99477 TGGAATGGAATTGAATAGAATGG + Intergenic
1203304851 22_KI270736v1_random:102027-102049 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203305230 22_KI270736v1_random:104504-104526 TGGAGTGGAATGCAATGGATTGG + Intergenic
1203305253 22_KI270736v1_random:104679-104701 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203305400 22_KI270736v1_random:105618-105640 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203305670 22_KI270736v1_random:107387-107409 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1203305981 22_KI270736v1_random:109496-109518 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203306030 22_KI270736v1_random:109821-109843 TGGAGTGGAATGATATGGAATGG + Intergenic
1203306119 22_KI270736v1_random:110393-110415 TGGAGCGGAATATAATAGATTGG + Intergenic
1203306129 22_KI270736v1_random:110463-110485 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203306515 22_KI270736v1_random:113011-113033 TGGAGTGGAATGCAATGGAGTGG + Intergenic
1203306535 22_KI270736v1_random:113141-113163 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203307141 22_KI270736v1_random:117135-117157 TGGAGTGTAATAAAATAGATTGG + Intergenic
1203307264 22_KI270736v1_random:117959-117981 TGGAGTGGAGTGCAATGGATTGG + Intergenic
1203307436 22_KI270736v1_random:119151-119173 TGGAGTGGAGTGCAATAGAATGG + Intergenic
1203307515 22_KI270736v1_random:119755-119777 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203307906 22_KI270736v1_random:122373-122395 TGGAGTGGAATAAAATAGAATGG + Intergenic
1203308349 22_KI270736v1_random:125115-125137 TGGAGTGGAATGCAATGGAGTGG + Intergenic
1203308625 22_KI270736v1_random:126910-126932 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203309136 22_KI270736v1_random:130371-130393 TGGAGTGGAATGGAATTGATTGG + Intergenic
1203309249 22_KI270736v1_random:131086-131108 TGCAGTGGAATGCAATAGAAAGG + Intergenic
1203309368 22_KI270736v1_random:131831-131853 TGGAGTGGAATTGAGTAGAGTGG + Intergenic
1203309439 22_KI270736v1_random:132326-132348 TGGAGTGGAATACAATGGAATGG + Intergenic
1203309461 22_KI270736v1_random:132478-132500 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203309558 22_KI270736v1_random:133125-133147 TGGAGTGGAATGGAATAGATGGG + Intergenic
1203309752 22_KI270736v1_random:134421-134443 TCGAGTGGAATTGAATAGACTGG + Intergenic
1203309773 22_KI270736v1_random:134596-134618 TGGAATGGAATTCAATGGAATGG + Intergenic
1203309867 22_KI270736v1_random:135216-135238 TGGAATGGAATTGTATGGAAAGG + Intergenic
1203310300 22_KI270736v1_random:138037-138059 TGGAGTGGAATGGAGTAGATTGG + Intergenic
1203310325 22_KI270736v1_random:138182-138204 TGGAGTGGAATGGAATAGAGTGG + Intergenic
1203310692 22_KI270736v1_random:140635-140657 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203310723 22_KI270736v1_random:140860-140882 TGGAGTGGAATGGAATAGAGTGG + Intergenic
1203310762 22_KI270736v1_random:141115-141137 TGGAGTGGAATGCAATGGAAAGG + Intergenic
1203311423 22_KI270736v1_random:145532-145554 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203311432 22_KI270736v1_random:145592-145614 TGGAATGGAATTGAATGGATTGG + Intergenic
1203311546 22_KI270736v1_random:146302-146324 TGGAGTGGAATTGAATAGATTGG + Intergenic
1203311632 22_KI270736v1_random:146867-146889 TGGAATGGAATTAAATGGATTGG + Intergenic
1203311952 22_KI270736v1_random:148958-148980 TGGAGTGGAATTGAATGGAAAGG + Intergenic
1203312121 22_KI270736v1_random:150130-150152 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1203312413 22_KI270736v1_random:152052-152074 TGGAGTGGAATGTTTTAGAATGG + Intergenic
1203312431 22_KI270736v1_random:152142-152164 TGGAGTGGAATTAAATGGAGTGG + Intergenic
1203312635 22_KI270736v1_random:153461-153483 TGGAAAGGAATTCAATAGATTGG + Intergenic
1203312743 22_KI270736v1_random:154176-154198 TGGAGTGGATTTTAGTAGATTGG + Intergenic
1203312760 22_KI270736v1_random:154291-154313 TGGAGTGGATTTTAGTAGATTGG + Intergenic
1203312956 22_KI270736v1_random:155582-155604 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203313252 22_KI270736v1_random:157541-157563 TGGAGTGGAATGCAATGTATTGG + Intergenic
1203313778 22_KI270736v1_random:166178-166200 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203313908 22_KI270736v1_random:166971-166993 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203314095 22_KI270736v1_random:171027-171049 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203314233 22_KI270736v1_random:171979-172001 TGGAATGGAATGCAATGGATTGG + Intergenic
1203314704 22_KI270736v1_random:175123-175145 TGGAGTGGAATGCAGTAGAATGG + Intergenic
1203314889 22_KI270736v1_random:179881-179903 TGGAGTGGAATGGTATGGAATGG + Intergenic
1203316923 22_KI270737v1_random:23437-23459 TGGAGTGGAATGGAATCGATTGG - Intergenic
1203317308 22_KI270737v1_random:26207-26229 TGGAATGGAATTCAATGGAATGG - Intergenic
1203318176 22_KI270737v1_random:32434-32456 TGGAATGGAATACAATAGAATGG - Intergenic
1203318919 22_KI270737v1_random:37870-37892 TGGAGTGGAATTTAATTGAATGG - Intergenic
951289868 3:20862641-20862663 TGGGGTGGAATGATATAGTTTGG - Intergenic
952022581 3:29040988-29041010 AGGAGTGGAATTATATGGTTTGG + Intergenic
955551099 3:60086349-60086371 AGGAGTGGAATGCTATGGTTTGG - Intronic
955694652 3:61623693-61623715 TGGAGGGGATGTCTATAAATAGG + Intronic
957797528 3:85030916-85030938 TTGAGTGGAATTTTATAAAGGGG + Intronic
957873219 3:86113435-86113457 AGGAGTGGAATGATATAGTTTGG + Intergenic
958871752 3:99567627-99567649 TGGAGTGGAATAATAGATATTGG - Intergenic
959783268 3:110262221-110262243 TGTAGTGAAATACTATAAATAGG + Intergenic
961342494 3:126237843-126237865 CGGAGTGGAATTATATGGTTTGG - Intergenic
962559852 3:136594237-136594259 TGGAGAGGAATTCTCAAGCTGGG - Intronic
963225526 3:142858026-142858048 TGGAGTGGAAGTCAATAGTCTGG - Intronic
964092284 3:152891732-152891754 AGGAGTGGAATTATATGGTTGGG - Intergenic
964560069 3:157984900-157984922 TGGAGTGAAAATATATACATGGG + Intergenic
966097982 3:176228979-176229001 AGGAGTGGAATTATATGGTTTGG + Intergenic
970528243 4:16954849-16954871 AGGACTGGAATGCTATAGTTTGG - Intergenic
971744950 4:30567158-30567180 TGGGTTGGAATTATATAGTTTGG + Intergenic
972139190 4:35935490-35935512 TAGAGTGGAATTATATAAAATGG + Intergenic
972549897 4:40122184-40122206 TGGAGTGGGATTCAATATCTCGG - Exonic
973015632 4:45134215-45134237 TGGAGTGGAACGATATAGTTTGG - Intergenic
973349533 4:49093264-49093286 TGGAATGGAATTCAATGGAATGG - Intergenic
973349810 4:49094878-49094900 TGGAATGGAATTCAATGGAATGG - Intergenic
973350949 4:49101820-49101842 TGGAATGGAATGCAATAGAATGG - Intergenic
973350975 4:49102000-49102022 TGGAATGGAATGGTATGGATTGG - Intergenic
973351057 4:49102469-49102491 TGGAGTGGAATGGAATGGATTGG - Intergenic
973351863 4:49107583-49107605 TGGAATGGAATGCAATAGAATGG - Intergenic
973351895 4:49107783-49107805 TGGAATGGAATGGTATGGATTGG - Intergenic
973351982 4:49108286-49108308 TGGAGTGGAATGGAATGGATTGG - Intergenic
973352103 4:49109016-49109038 TGGAATGGAATGCAATAGAATGG - Intergenic
973352129 4:49109196-49109218 TGGAATGGAATGGTATGGATTGG - Intergenic
973352207 4:49109650-49109672 TGGAGTGGAATGGAATGGATTGG - Intergenic
973352347 4:49110466-49110488 TGGAGTGGAATTTAATGGAGTGG - Intergenic
973352546 4:49111680-49111702 TGGAGTGGAATGGTATGGAATGG - Intergenic
973352673 4:49112465-49112487 TGGAGTGGAATTTAATGGAGTGG - Intergenic
973352849 4:49113559-49113581 TGGAGTGGAATGGTATGGAATGG - Intergenic
973352921 4:49113994-49114016 TGGAGTGGAATGGTATGGAATGG - Intergenic
973353090 4:49114993-49115015 TGGAATGGAATGCAATGGATTGG - Intergenic
973353183 4:49115563-49115585 TGGAATGGAATGCAATGGATTGG - Intergenic
973353417 4:49117039-49117061 TGGAGTGGAATTGTATGGAATGG - Intergenic
973353498 4:49117559-49117581 TGGAGTGGAATGGTATGGAATGG - Intergenic
973353879 4:49119870-49119892 TGGAATGGAATGCAATAGAATGG - Intergenic
973353913 4:49120085-49120107 TGGAATGGAATGGTATGGATTGG - Intergenic
973354314 4:49122525-49122547 TGGAGTGGAATGGTATGGAATGG - Intergenic
973354638 4:49124377-49124399 TGGAGTGGAATGGAATAGATTGG - Intergenic
973354802 4:49125371-49125393 TGGAGTGGAATTGTATGGAATGG - Intergenic
973355539 4:49129821-49129843 TGGAGTGGAATGGTATGGAATGG - Intergenic
973355762 4:49131055-49131077 TGAAGTGGAATGGTATAGAATGG - Intergenic
973355812 4:49131374-49131396 TGGAGTGGAATGGTATGGAATGG - Intergenic
973355942 4:49132164-49132186 TGGAGTGGAATGGAATAGATTGG - Intergenic
973356109 4:49133168-49133190 TGGAGTGGAATTGTATGGAATGG - Intergenic
973356347 4:49134622-49134644 TGGAATGGAATTGAATAGAATGG - Intergenic
973356730 4:49136885-49136907 TGGAGTGGAATGGTATGGAATGG - Intergenic
973357014 4:49138508-49138530 TGAAGTGGAATGGTATAGAATGG - Intergenic
973357064 4:49138827-49138849 TGGAGTGGAATGGTATGGAATGG - Intergenic
973357125 4:49139164-49139186 TGGAGTGGAATGATATGGAATGG - Intergenic
973357185 4:49139529-49139551 TGGAGTGGAATGGTATGGAATGG - Intergenic
973357437 4:49140947-49140969 TGAAGTGGAATGGTATAGAATGG - Intergenic
973357486 4:49141266-49141288 TGGAGTGGAATGGTATGGAATGG - Intergenic
973357547 4:49141603-49141625 TGGAGTGGAATGATATGGAATGG - Intergenic
973357608 4:49141968-49141990 TGGAGTGGAATGGTATGGAATGG - Intergenic
973357817 4:49143176-49143198 TGAAGTGGAATGGTATAGAATGG - Intergenic
973357871 4:49143496-49143518 TGGAGTGGAATGGTATGGAATGG - Intergenic
973357931 4:49143833-49143855 TGGAGTGGAATGATATGGAATGG - Intergenic
973357997 4:49144223-49144245 TGGAGTGGAATGGTATGGAATGG - Intergenic
973358177 4:49145265-49145287 TGGAATGGAATTCAATGGAATGG - Intergenic
973358438 4:49146851-49146873 TGGAGTGGAATGGTATGGAATGG - Intergenic
973358806 4:49149044-49149066 TGGAGTGGAATGGTATGGAATGG - Intergenic
973359300 4:49151971-49151993 TGGAGTGGAATGGTATGGAATGG - Intergenic
973359410 4:49152566-49152588 TGGAGTGGAATGGTATGGAATGG - Intergenic
973359464 4:49152889-49152911 TGGAGTGGAATCGTATGGAATGG - Intergenic
973359538 4:49153318-49153340 TGGAGTGGAATGGTATGGAATGG - Intergenic
973360067 4:49156551-49156573 TGGAATGGAATTCAATGGAATGG - Intergenic
973400012 4:49631356-49631378 TGGAATGGAATTCAATGGAATGG + Intergenic
973400598 4:49634988-49635010 TGGAGTGGAATGGTATGGAATGG + Intergenic
973401333 4:49639691-49639713 TGGAGTGGAATTGTATGGAATGG + Intergenic
973401516 4:49640739-49640761 TGGAGTGGAATGGTATGGAATGG + Intergenic
973401602 4:49641229-49641251 TGGAGTGGAATGGTATGGAATGG + Intergenic
973401660 4:49641569-49641591 TGGAGTGGAATGGTATGGAATGG + Intergenic
973401678 4:49641664-49641686 TGGAGTGGAATGGTATGGAATGG + Intergenic
973401835 4:49642612-49642634 TGGAGTGGAATGGAATAGAATGG + Intergenic
973402092 4:49644363-49644385 TGGAGTGGAATTGAATTGAATGG + Intergenic
973402202 4:49645037-49645059 TGGAATGGAATGCAATGGATTGG + Intergenic
973402214 4:49645117-49645139 TGGAGTGGAATGGTATGGAATGG + Intergenic
973402471 4:49646649-49646671 TGGAGTGGAATCGTACGGATTGG + Intergenic
973402588 4:49647368-49647390 TGGAGTGGAATGGTATGGAATGG + Intergenic
973402650 4:49647723-49647745 TGGAGTGGAATGGTATGGAATGG + Intergenic
973403204 4:49651294-49651316 TGGAGTGGAATGGTATGGAAAGG + Intergenic
973403480 4:49652914-49652936 TGGAGTGGAATGGTATGGAATGG + Intergenic
973600078 4:52533436-52533458 AGGATTGAAACTCTATAGATTGG - Intergenic
973909246 4:55563067-55563089 TGGAGTGGGATTCCAAAGACTGG - Intronic
975465517 4:74704979-74705001 AGGAGTGGGATCCTATAAATAGG + Intergenic
976752640 4:88465460-88465482 TGGAGTAGAATTACATAAATGGG + Intronic
977197757 4:94083396-94083418 AGGAGTGGAATTATATAGTTTGG - Intergenic
978896467 4:113894356-113894378 TGGAGTGTTATTCTATTGAGGGG - Intergenic
978915597 4:114123336-114123358 AGGGGTGGAATTATATAGTTTGG - Intergenic
979052695 4:115954387-115954409 TAGAGTGCAGTTCTCTAGATTGG + Intergenic
980989863 4:139729967-139729989 TTGAGAAGAATTCTATAGAATGG - Intronic
983371225 4:166861433-166861455 TGAAGTGGAATTCAATAAATTGG - Intronic
983790493 4:171791675-171791697 TGGAGTGGGATTTAATAAATAGG + Intergenic
984310026 4:178046045-178046067 TGGAGAGGAGTTCTGTAGAGAGG + Intergenic
1202750442 4_GL000008v2_random:1127-1149 TGGAGTGGAATTTAATGGAATGG + Intergenic
1202750589 4_GL000008v2_random:2147-2169 TGGAGTGGAATTGTATGGAATGG + Intergenic
1202750756 4_GL000008v2_random:3174-3196 TGGAGTGGAATTGAATGGAATGG + Intergenic
1202751182 4_GL000008v2_random:5939-5961 TGGAGTGGAATGCAATGGAATGG + Intergenic
986352236 5:6891393-6891415 TGGACTGGATTTCAGTAGATGGG + Intergenic
986678499 5:10211635-10211657 TGGGGTGGAATTGTATGGTTTGG + Intergenic
987607657 5:20158180-20158202 TGGAGTTGATTTCTATAAAGGGG + Intronic
987680883 5:21134237-21134259 TGGAGTGGAATGATATGGTTTGG + Intergenic
987985008 5:25134772-25134794 AGGAGTGGAATTATATGGTTTGG + Intergenic
988426731 5:31073598-31073620 TGGGGTGGAATGCTATGGTTTGG - Intergenic
989911514 5:49659793-49659815 TGGAGTGGAATAGAATGGATTGG - Intergenic
989911579 5:49660203-49660225 TGGAATGGAATTTAATGGATTGG - Intergenic
991700221 5:69310216-69310238 TGGAGTGGAATGATATGGTTTGG + Intronic
992261417 5:74974297-74974319 TAGAGAGGAATTCTCAAGATTGG + Intergenic
993588291 5:89760310-89760332 TGGATTGGAATTCTCTACAAAGG - Intergenic
993777103 5:92012943-92012965 TGGAGTGGAATGATATGGTTTGG + Intergenic
994682402 5:102905339-102905361 TGTAGTGCAATTTGATAGATAGG - Intronic
994938492 5:106288208-106288230 TGCAGTGGGATTCTATGGACAGG + Intergenic
996164475 5:120208437-120208459 TGGAGTGGATTTCTGAAGAGTGG + Intergenic
997420782 5:133765172-133765194 TGAAGTGGATTTCTGTAGAATGG + Intergenic
997692993 5:135839655-135839677 AGGAGTGGAATGATATAGTTTGG + Intronic
998193313 5:140044559-140044581 TGGAGTGGAAGTAGATAAATTGG - Intergenic
998863064 5:146464542-146464564 TGGAGTGGAATTCTTACCATAGG + Intronic
1000308484 5:160018344-160018366 TGGAGAGGACTGCTTTAGATTGG + Intronic
1001112766 5:168911616-168911638 TGGACTGGAATTATTTAGAAGGG - Intronic
1002330886 5:178439838-178439860 TGTAGTGGTATTCCATTGATTGG - Intronic
1007617231 6:43187258-43187280 GGGACTGGAATCCTATGGATGGG + Exonic
1010533885 6:77001449-77001471 TGAAATGGTATTCTATAAATTGG + Intergenic
1013877685 6:114854428-114854450 TGTAGTGGAATTCCAAAGAGGGG + Intergenic
1014509986 6:122308682-122308704 AGGGGTGGAATTATATAGTTTGG + Intergenic
1014665466 6:124231454-124231476 TGGGGTGGAATTATATGGTTTGG + Intronic
1015082867 6:129249286-129249308 TGGAGTGGAATTTTAAAAAAAGG + Intronic
1015709518 6:136124289-136124311 TGGAGTGCAATTTTATACACTGG + Intronic
1016204047 6:141451701-141451723 TGGAATGGAATTCAATGGAATGG + Intergenic
1016595136 6:145790256-145790278 AGGAGTGGAATGATATGGATTGG - Intergenic
1018903247 6:168061608-168061630 TGGAGTGGAATTCTATAGATGGG - Intronic
1020493697 7:8821574-8821596 AGGAGTGGAATACTATGGTTTGG - Intergenic
1021205810 7:17779340-17779362 AGGAGGGGAATACTATATATAGG + Intergenic
1022196779 7:28075784-28075806 TAGGGTGGAATTCTAGAAATGGG + Intronic
1025484619 7:61031480-61031502 TGGAATGGAATTCAATTGAATGG + Intergenic
1027362264 7:77421664-77421686 TGGATTGGAATTATAAATATTGG + Intergenic
1027367798 7:77476640-77476662 TGGAGTGGAATAATAGACATTGG + Intergenic
1028291980 7:89076204-89076226 TGGGGTGGAATTATATGGTTTGG + Intronic
1028784358 7:94774639-94774661 AGGGGTGGAATTATATAGTTTGG + Intergenic
1029704549 7:102269315-102269337 AGGGGTGGAATTATATAGTTTGG - Intronic
1031435505 7:121727958-121727980 TGGGGTGGAATAATATAGTTTGG - Intergenic
1032961643 7:137042118-137042140 TGGAGTGGAATAATAGACATTGG - Intergenic
1041207902 8:55517093-55517115 TGGAGTGGAATAATAGACATTGG + Intronic
1041876940 8:62699733-62699755 TGTAGTGGAATTCCACAGAAGGG + Intronic
1044912194 8:97072122-97072144 TAGAGTGGAATTACCTAGATTGG + Intronic
1046264459 8:111813554-111813576 AGGAGTGGAATTATATGGTTTGG - Intergenic
1047199414 8:122752316-122752338 TGCAGTGAAGTTCTATAGCTTGG - Intergenic
1050894659 9:10872011-10872033 AGGAGTGGAATGATATAGTTTGG - Intergenic
1050945511 9:11511675-11511697 AGGAGTGGAATGATATAGTTTGG + Intergenic
1050953850 9:11629938-11629960 TGGGGTGGAATTATATGGTTTGG + Intergenic
1052053850 9:23881971-23881993 AGGAGTGGAATGATATGGATTGG - Intergenic
1052090361 9:24320078-24320100 TGGAGTGAAATGATATAGTTTGG - Intergenic
1053700348 9:40683692-40683714 TGTTCTGGAATTCTATATATGGG - Intergenic
1054311640 9:63483090-63483112 TGTTCTGGAATTCTATATATGGG - Intergenic
1054410421 9:64807243-64807265 TGTTCTGGAATTCTATATATGGG - Intergenic
1054869742 9:70038356-70038378 TGGAATGGAATGCAATAGAATGG + Intergenic
1059503797 9:114779511-114779533 TGGAGTGGAGCTCTAGGGATTGG + Intergenic
1061689949 9:132319187-132319209 TGGAGAGGAATTCAATATATTGG - Intronic
1203719085 Un_GL000216v2:56-78 TGGAATGGAATTGAATAGAATGG - Intergenic
1203719686 Un_GL000216v2:4305-4327 TGCAATGGAATTCAATAGAATGG - Intergenic
1203719824 Un_GL000216v2:5291-5313 TGGAATGGAATTGAATGGATTGG - Intergenic
1203720191 Un_GL000216v2:7938-7960 TGGAATAGAATTCAATAGAATGG - Intergenic
1203720450 Un_GL000216v2:9696-9718 TGGAATGGTATTCAATAGAATGG - Intergenic
1203720526 Un_GL000216v2:10189-10211 TGGAATGGAATGGAATAGATTGG - Intergenic
1203720571 Un_GL000216v2:10524-10546 TGGAGTGAAATGCTGTAGAAAGG - Intergenic
1203720590 Un_GL000216v2:10667-10689 TGGAGTGGAATGGAATAGAATGG - Intergenic
1203720763 Un_GL000216v2:11727-11749 TGGAATGGAATTCAAAAGAATGG - Intergenic
1203720797 Un_GL000216v2:11994-12016 TGGAATGGAATTCAATGGAATGG - Intergenic
1203720971 Un_GL000216v2:13126-13148 TGGAGTGGAATATTATGGAATGG - Intergenic
1203721495 Un_GL000216v2:16650-16672 TGGAGTGGAGTTGTATGGAATGG - Intergenic
1203721920 Un_GL000216v2:19623-19645 TGGAATGGAATTGAATGGATAGG - Intergenic
1203722582 Un_GL000216v2:24339-24361 TGGAATGGAATGCTATGGAATGG - Intergenic
1203722617 Un_GL000216v2:24573-24595 TGGAATGGAATGCAATAGAATGG - Intergenic
1203722618 Un_GL000216v2:24588-24610 TGGAATGGAATTCAATGGAATGG - Intergenic
1203723307 Un_GL000216v2:29391-29413 TGGAATGGAATTGAATGGATAGG - Intergenic
1203724293 Un_GL000216v2:37299-37321 TGGAATGGAATAGAATAGATAGG - Intergenic
1203724695 Un_GL000216v2:40226-40248 TGGAATGGAATTCTCTCGAATGG - Intergenic
1203725502 Un_GL000216v2:46337-46359 TGGAGTGGAATGGAATAGAATGG - Intergenic
1203725767 Un_GL000216v2:48290-48312 TGGAGTGGAATGCAATGGAATGG - Intergenic
1203725874 Un_GL000216v2:49084-49106 TGGAATGGAATTGAATAGAATGG - Intergenic
1203726909 Un_GL000216v2:57277-57299 TGGAATGGAATGCAATAGAGTGG - Intergenic
1203727785 Un_GL000216v2:64330-64352 TGGAGTTGAATTGAATAGAAAGG - Intergenic
1203728576 Un_GL000216v2:70880-70902 TGGAATGGAATGCAATAGAATGG - Intergenic
1203728965 Un_GL000216v2:73821-73843 TGGAATGGAATTCCATAGAATGG - Intergenic
1203730215 Un_GL000216v2:83190-83212 TGGAGTGGAATGGAATAGAATGG - Intergenic
1203730254 Un_GL000216v2:83529-83551 TGGAGTTGAATGCAATAGAATGG - Intergenic
1203731691 Un_GL000216v2:97884-97906 TGGAGTGGAAATCTTTATACTGG + Intergenic
1203383844 Un_KI270435v1:92429-92451 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1203385465 Un_KI270438v1:46710-46732 TGGAGTGGAATGCAATGGAGGGG + Intergenic
1203386133 Un_KI270438v1:57658-57680 TGGAGTGGAATGGTATGGAATGG + Intergenic
1203386376 Un_KI270438v1:59428-59450 TGGAATGGAATTGAATAGAATGG + Intergenic
1203386739 Un_KI270438v1:62307-62329 TGAAATGGAATTCAATAGAAAGG + Intergenic
1203387066 Un_KI270438v1:65738-65760 TGGAGTGGAATTGAATTGAATGG + Intergenic
1203387341 Un_KI270438v1:67678-67700 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203387501 Un_KI270438v1:68832-68854 TGGAGTGGAATGAAATGGATTGG + Intergenic
1203387614 Un_KI270438v1:69602-69624 TGGAGTGGAATAGAATAGAATGG + Intergenic
1203387702 Un_KI270438v1:70257-70279 TGGAGTGGAATTGTATGGAATGG + Intergenic
1203387756 Un_KI270438v1:70617-70639 TGGAATGGAATTGAATAGAATGG + Intergenic
1203387876 Un_KI270438v1:71496-71518 TGGAATGGAATGCAATAGAATGG + Intergenic
1203389253 Un_KI270438v1:82493-82515 TGGAATGGAATTGAATAGAATGG + Intergenic
1203389485 Un_KI270438v1:84487-84509 TGGAATGGAATGCAATAGAATGG + Intergenic
1203389684 Un_KI270438v1:86211-86233 TGGAATGGAATTAAATAGAATGG + Intergenic
1203390693 Un_KI270438v1:94722-94744 TGGAATGGAATTCAACAGAATGG + Intergenic
1203391049 Un_KI270438v1:97519-97541 TGGAGTCGAATTGAATAGAATGG + Intergenic
1203391325 Un_KI270438v1:99791-99813 TGGAATGGAATTAGATAGAATGG + Intergenic
1203391481 Un_KI270438v1:101085-101107 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203391843 Un_KI270438v1:104197-104219 TGGAATGGAATCGAATAGATTGG + Intergenic
1203391959 Un_KI270438v1:105112-105134 TGGAATGGAATCATATAGAATGG + Intergenic
1203392043 Un_KI270438v1:105850-105872 TGGAATGGAATTGGATAGAATGG + Intergenic
1203392527 Un_KI270438v1:109921-109943 TGGAATGGAATCATATAGAATGG + Intergenic
1203392670 Un_KI270438v1:111214-111236 TGGAATGGAATCATATAGAATGG + Intergenic
1203342753 Un_KI270442v1:9659-9681 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203342775 Un_KI270442v1:9779-9801 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203342829 Un_KI270442v1:10133-10155 TGGAATGGAATTCAACGGATTGG + Intergenic
1203342894 Un_KI270442v1:10498-10520 TGGAGTGGAATGGTATGGAATGG + Intergenic
1203343537 Un_KI270442v1:15200-15222 TGGAATGGAATCCAATGGATTGG + Intergenic
1203343580 Un_KI270442v1:15560-15582 TGGAATGGAATCCAATGGATTGG + Intergenic
1203343786 Un_KI270442v1:17134-17156 TGGAATGGAATTGAATGGATTGG + Intergenic
1203343807 Un_KI270442v1:17274-17296 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203343813 Un_KI270442v1:17314-17336 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203343900 Un_KI270442v1:17890-17912 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203343929 Un_KI270442v1:18140-18162 TGGAATGGAATCCAATGGATTGG + Intergenic
1203344168 Un_KI270442v1:19809-19831 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203344261 Un_KI270442v1:20459-20481 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203344359 Un_KI270442v1:22865-22887 TGGAGAGGAATTGAATGGATTGG + Intergenic
1203344421 Un_KI270442v1:23315-23337 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203344434 Un_KI270442v1:23395-23417 TGGAGTGGAATGTTATGGAATGG + Intergenic
1203344506 Un_KI270442v1:23940-23962 TGGAGTGGAATTGAGTTGATTGG + Intergenic
1203344656 Un_KI270442v1:25121-25143 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203344666 Un_KI270442v1:25181-25203 TGGAGTGGAATGCTGTGGAGTGG + Intergenic
1203345356 Un_KI270442v1:30305-30327 TGGAATGGAATCCAATAGAATGG + Intergenic
1203345558 Un_KI270442v1:31612-31634 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203345891 Un_KI270442v1:33939-33961 TGGAGTGGAATTGAATAGAATGG + Intergenic
1203346019 Un_KI270442v1:34863-34885 TGGAATGGAATGCAATGGATTGG + Intergenic
1203346056 Un_KI270442v1:35173-35195 TGGAATGGAATGCAATGGATTGG + Intergenic
1203346357 Un_KI270442v1:37368-37390 TGGAGTGGAATGGAATAGAATGG + Intergenic
1203346619 Un_KI270442v1:39291-39313 TGGAGTGGAAAGCAATAGAATGG + Intergenic
1203346764 Un_KI270442v1:40404-40426 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203346819 Un_KI270442v1:40734-40756 TGGAATGGAATGCAATGGATTGG + Intergenic
1203346983 Un_KI270442v1:41923-41945 TGGAGTGGAGTGCAATAGAGTGG + Intergenic
1203347236 Un_KI270442v1:43762-43784 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203347368 Un_KI270442v1:44581-44603 TGGAGTGGAATGAAATAGAATGG + Intergenic
1203347382 Un_KI270442v1:44681-44703 TGGAGTGGAGTGCAATAGAATGG + Intergenic
1203347441 Un_KI270442v1:45086-45108 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203347509 Un_KI270442v1:45491-45513 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203347697 Un_KI270442v1:46871-46893 TGGAATGGAATTCAATAGAGTGG + Intergenic
1203347759 Un_KI270442v1:47267-47289 TGGAGTGGAATTCAATGGAATGG + Intergenic
1203347851 Un_KI270442v1:47926-47948 TGGAGTGGAATGAAATAGAATGG + Intergenic
1203348271 Un_KI270442v1:50912-50934 TGGAGTGGAATGCCATGGAATGG + Intergenic
1203348439 Un_KI270442v1:56515-56537 TGGAATGGAATTGAATGGATGGG + Intergenic
1203348485 Un_KI270442v1:56805-56827 TGGAGTGGAATGCAATGGAATGG + Intergenic
1203348535 Un_KI270442v1:57119-57141 TGGAGTGGAATGGAATAGAGTGG + Intergenic
1203348572 Un_KI270442v1:57424-57446 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203348701 Un_KI270442v1:58335-58357 TGGAGTGCAATGCAATAGAGTGG + Intergenic
1203349160 Un_KI270442v1:61515-61537 TGGAGTGGAATGCAATGGAACGG + Intergenic
1203349463 Un_KI270442v1:67954-67976 TGGAGTGGAATGCAATGGAGTGG + Intergenic
1203349478 Un_KI270442v1:68068-68090 TGGAGTGGAATGGAATGGATTGG + Intergenic
1203349593 Un_KI270442v1:68911-68933 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1203349907 Un_KI270442v1:71130-71152 TGGAATGGAATTGAATGGATAGG + Intergenic
1203350051 Un_KI270442v1:72121-72143 TGGAGTGGAGTGGAATAGATTGG + Intergenic
1203350173 Un_KI270442v1:75089-75111 TGGATTGGAATGCAATAGAATGG + Intergenic
1203350838 Un_KI270442v1:80084-80106 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203351277 Un_KI270442v1:83332-83354 TGGAGTGGAATTCAATGGAATGG + Intergenic
1203351534 Un_KI270442v1:85179-85201 TGGAATGGAATGCTATAGAATGG + Intergenic
1203351566 Un_KI270442v1:85409-85431 TGGAATGGAATGCAATAGAATGG + Intergenic
1203351594 Un_KI270442v1:85650-85672 TGGAATGGAATGCAATAGAGTGG + Intergenic
1203351730 Un_KI270442v1:86712-86734 TGGAATGGAATGCAATAGAATGG + Intergenic
1203351755 Un_KI270442v1:86931-86953 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203351788 Un_KI270442v1:87166-87188 TGGAATGGAATGCAATAGAATGG + Intergenic
1203351820 Un_KI270442v1:87411-87433 TGGAATTGAATGCAATAGATAGG + Intergenic
1203351871 Un_KI270442v1:87862-87884 TGGAATGGAATGCAATAGAGTGG + Intergenic
1203352003 Un_KI270442v1:88906-88928 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352029 Un_KI270442v1:89125-89147 TGGAGTGGAATTGAATGGAATGG + Intergenic
1203352060 Un_KI270442v1:89350-89372 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352092 Un_KI270442v1:89595-89617 TGGAATTGAATGCAATAGATAGG + Intergenic
1203352121 Un_KI270442v1:89820-89842 TGGAATGGAATGCTATAGAATGG + Intergenic
1203352153 Un_KI270442v1:90030-90052 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352251 Un_KI270442v1:90818-90840 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352312 Un_KI270442v1:91266-91288 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352331 Un_KI270442v1:91421-91443 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352433 Un_KI270442v1:92170-92192 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352490 Un_KI270442v1:92644-92666 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352527 Un_KI270442v1:92929-92951 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352542 Un_KI270442v1:93029-93051 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352560 Un_KI270442v1:93224-93246 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352638 Un_KI270442v1:93839-93861 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352668 Un_KI270442v1:94106-94128 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352748 Un_KI270442v1:94721-94743 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352763 Un_KI270442v1:94836-94858 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352780 Un_KI270442v1:94966-94988 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352799 Un_KI270442v1:95131-95153 TGGAATGGAATGCCATAGAATGG + Intergenic
1203352810 Un_KI270442v1:95206-95228 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352856 Un_KI270442v1:95581-95603 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352921 Un_KI270442v1:96131-96153 TGGAATGGAATGCAATAGAATGG + Intergenic
1203352980 Un_KI270442v1:96538-96560 TGGCATGGAATGCAATAGATTGG + Intergenic
1203352993 Un_KI270442v1:96628-96650 TGGAATGGAATGCAATAGAATGG + Intergenic
1203395350 Un_KI270512v1:22405-22427 TGGAGTAGAATGCAATAGAAAGG + Intergenic
1203403250 Un_KI270519v1:136627-136649 TGGAGTGGAATGGTATGGAATGG + Intergenic
1203403269 Un_KI270519v1:136747-136769 TGGAGTGGAATGGAATAGAGTGG + Intergenic
1203403295 Un_KI270519v1:136932-136954 TGGAGTGGAATGGCATGGATTGG + Intergenic
1203414327 Un_KI270589v1:41757-41779 TGGAGTGGAATGGAATGGATTGG - Intergenic
1203414488 Un_KI270589v1:42941-42963 TGCAGTGGAATGCTATTGAATGG - Intergenic
1203414679 Un_KI270589v1:44156-44178 TGGAGTGGAATGGAATGGATTGG - Intergenic
1203674365 Un_KI270756v1:9340-9362 TGGAATGGAATTGAATAGAATGG - Intergenic
1203674480 Un_KI270756v1:10241-10263 AGGAGTGGAATTGAATAGAATGG - Intergenic
1203675492 Un_KI270756v1:18742-18764 TGGAGTGGAATCGTAAGGATTGG - Intergenic
1203676018 Un_KI270756v1:23165-23187 TCGAGTGGAATGCAATAGAATGG - Intergenic
1203676132 Un_KI270756v1:24111-24133 TCGAGTGGAATGCAATAGAATGG - Intergenic
1203676645 Un_KI270756v1:28279-28301 TGGAATGGAATAGAATAGATTGG - Intergenic
1203677344 Un_KI270756v1:34080-34102 TGGAATGGAATCAAATAGATTGG - Intergenic
1203677401 Un_KI270756v1:34575-34597 TGGAATGGAATGCAATAGAACGG - Intergenic
1203679532 Un_KI270756v1:51874-51896 TGGAATGGAATTGAATAGAAAGG - Intergenic
1203679745 Un_KI270756v1:53713-53735 TGGAATGGAATTAAATAGAATGG - Intergenic
1203680464 Un_KI270756v1:59764-59786 TGGAATGGACTGGTATAGATCGG - Intergenic
1203681161 Un_KI270756v1:65299-65321 TGGAATGGAATTGTATGGAATGG - Intergenic
1203682490 Un_KI270756v1:76484-76506 TGGAGTGGAATGGTATCGAATGG - Intergenic
1192192407 X:68999410-68999432 TGCAGTGGAAGTCTAAAGAAGGG + Intergenic
1192697786 X:73436748-73436770 TGGGGTGGAATGCTACAGTTTGG - Intergenic
1193043019 X:77023885-77023907 TGGGGTGGAATGATATAGTTTGG - Intergenic
1193256582 X:79355725-79355747 AGGAGTGGAATGCTATGGTTTGG + Intergenic
1193557606 X:82975308-82975330 AGGGGTGGAATTATATAGTTTGG + Intergenic
1194369037 X:93047730-93047752 AGGAGTGGAATTATATGGTTTGG - Intergenic
1196716703 X:118818619-118818641 TGGTGTGGTGTTCTATATATTGG + Intergenic
1197812775 X:130462780-130462802 TGAAGTGGGATTCCATAGATAGG - Intergenic
1197930540 X:131690480-131690502 TGGAGGGGAATTCAGTTGATTGG + Intergenic
1198680940 X:139181593-139181615 TGGAGTGGCAGACTATAGCTGGG - Intronic
1199246391 X:145609966-145609988 TGGAGCTGAATTCCATAAATAGG + Intergenic
1199690857 X:150308193-150308215 TGAAGGGGAATCCTATAGATGGG - Intergenic
1200677243 Y:6164064-6164086 AGGAGTGGAATTATATGGTTTGG - Intergenic
1201096664 Y:10626807-10626829 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201096806 Y:10627706-10627728 TGGAGTGGAATGCTGTGGAATGG - Intergenic
1201097240 Y:10630688-10630710 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201097244 Y:10630708-10630730 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201097627 Y:10645880-10645902 TGGAGTGGAATGCTGTGGAATGG - Intergenic
1201097927 Y:10648026-10648048 TGGAGTGGAGTTTAATGGATTGG - Intergenic
1201098093 Y:10649120-10649142 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201098097 Y:10649140-10649162 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201098328 Y:10652201-10652223 TGGAGTGGAATTCAGTGGAAAGG - Intergenic
1201099370 Y:10659858-10659880 TGGAGTGGAATTGAATGGAATGG - Intergenic
1201099386 Y:10659973-10659995 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201099457 Y:10660492-10660514 TGGAGTGGAATTGAATGGAATGG - Intergenic
1201099646 Y:10661753-10661775 TGGAGTGGAATGCAATCGAATGG - Intergenic
1201100270 Y:10666412-10666434 TGGAGTGGAATGGAATAGAAAGG - Intergenic
1201100794 Y:10671232-10671254 TGGAGTGGAATGATATGGAGTGG - Intergenic
1201100918 Y:10672113-10672135 TGGATTGGAATTCCATGGAATGG - Intergenic
1201101017 Y:10672785-10672807 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201101057 Y:10673077-10673099 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201101131 Y:10673586-10673608 TGGAGTGGAATTGAATCGAATGG - Intergenic
1201101320 Y:10677475-10677497 TGGAATGGAATTCGATGGAGTGG - Intergenic
1201101409 Y:10678181-10678203 TGGAGTGGAATGGAATAGAGTGG - Intergenic
1201101560 Y:10679216-10679238 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201102144 Y:10686081-10686103 TGGAGTGGAATGCAATGGAAGGG - Intergenic
1201102782 Y:10690852-10690874 TGGAGTGGAATGGAATAGAAAGG - Intergenic
1201102970 Y:10692421-10692443 TGGATTGGAATTCCATGGAATGG - Intergenic
1201103030 Y:10692846-10692868 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201103067 Y:10693118-10693140 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201103109 Y:10693410-10693432 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201103812 Y:10748571-10748593 TGGAATGGAATTGTATCGAATGG - Intergenic
1201103877 Y:10749056-10749078 TGGAGTGGAATGAAATAGAATGG - Intergenic
1201104398 Y:10752736-10752758 TGGAGTGGAATGCAATGGAGTGG - Intergenic
1201104450 Y:10753042-10753064 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201104560 Y:10753818-10753840 TGGAGTGGAAGTGAAGAGATTGG - Intergenic
1201104767 Y:10755316-10755338 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201105176 Y:10758014-10758036 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201106225 Y:10765387-10765409 TGGAGTGGACTACAATAGAATGG - Intergenic
1201106917 Y:10770180-10770202 TGGAGTGGAATTTAATGGAATGG - Intergenic
1201107039 Y:10771016-10771038 TGGAGTGGAGTGGTATAGAGTGG - Intergenic
1201107898 Y:10777087-10777109 TGGAGTGGAATGGAATAGAGTGG - Intergenic
1201108052 Y:10778266-10778288 TGGAGTGGAATTGAATGGAGTGG - Intergenic
1201108156 Y:10778975-10778997 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201108336 Y:10780352-10780374 TGGAGTGGAATGGCGTAGATTGG - Intergenic
1201108759 Y:10783320-10783342 TGGAGTGGAGTTAAATGGATTGG - Intergenic
1201109365 Y:10787896-10787918 TGGAGTGGAATTGAGTAGAGTGG - Intergenic
1201109482 Y:10788767-10788789 TGGAATGGAATTCAGTAGATTGG - Intergenic
1201109594 Y:10789556-10789578 TGGAGTGGAATGGCATGGATTGG - Intergenic
1201109884 Y:10791395-10791417 TGGAGTGGAGTGCTGTGGATTGG - Intergenic
1201110125 Y:10793164-10793186 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201110594 Y:10796505-10796527 TGGAATGGAATTCAATGGAATGG - Intergenic
1201110979 Y:10799272-10799294 TGGAATGGAATGGAATAGATTGG - Intergenic
1201111322 Y:10801561-10801583 TGGAGTGGACTGTTATAGAGTGG - Intergenic
1201111406 Y:10802110-10802132 TGGAGTGGAATGGAATAGAGTGG - Intergenic
1201112070 Y:10806820-10806842 TGGAGTGGAATGGTACAGAGCGG - Intergenic
1201112581 Y:10811139-10811161 TGGAGTGGAATGCAATGGAATGG - Intergenic
1201113035 Y:10814457-10814479 TGGAATGGAATGGAATAGATGGG - Intergenic
1201113166 Y:10815380-10815402 TGGAGTGGAGTTCAGTGGATTGG - Intergenic
1201113486 Y:10818266-10818288 TGGAGTGGAATGGGACAGATAGG - Intergenic
1201113496 Y:10818336-10818358 TGGAGTGGAATTGAATGGAGTGG - Intergenic
1201113799 Y:10820363-10820385 TGGAGTGGAATGGAATAGAACGG - Intergenic
1201114029 Y:10821946-10821968 TGGAGTGGAATGGAATAGAAAGG - Intergenic
1201114037 Y:10821981-10822003 TGGAGTGGAGTTGAATAGAATGG - Intergenic
1201114066 Y:10822180-10822202 TGGAGTGGAATTTAATGGAATGG - Intergenic
1201114273 Y:10823573-10823595 TGGAGTGGAATACAATGGAATGG - Intergenic
1201114289 Y:10823686-10823708 TGGAGTGGAATTGAATGGAGGGG - Intergenic
1201114852 Y:10827714-10827736 TGGAATGGAATACAATAGAGCGG - Intergenic
1201114928 Y:10828181-10828203 TGGAATGGAATGCTATGGAATGG - Intergenic
1201114952 Y:10828366-10828388 TGGGGTGGAATGCTATGGAATGG - Intergenic
1201115215 Y:10830208-10830230 TGGAGTGGATTGCAATAGAGTGG - Intergenic
1201115313 Y:10830981-10831003 TGGAGTGGAATTCAGTGGAGTGG - Intergenic
1201115359 Y:10831305-10831327 TGGAGTGGAATGCAATGGAGTGG - Intergenic
1201115533 Y:10832555-10832577 TGGAGTGGAATGGAATAGAAGGG - Intergenic
1201116324 Y:10838037-10838059 TGGAGTGGAATTAAATGGAATGG - Intergenic
1201116669 Y:10840336-10840358 TGTAGTGGAATTGAATAGAGTGG - Intergenic
1201116841 Y:10841476-10841498 TGGAGTGGAATGAAATAGAAAGG - Intergenic
1201116874 Y:10841701-10841723 TGGAGTGGAATTGAATGGAGTGG - Intergenic
1201117023 Y:10842654-10842676 TGGAGTGGAATGCAATGGAATGG - Intergenic
1201117220 Y:10843982-10844004 TGGAGTGGAATCGAATGGATTGG - Intergenic
1201117303 Y:10844552-10844574 TGGAGTGGAGTTGAATAGAGTGG - Intergenic
1201117777 Y:10847756-10847778 TGGAGTGGAATTGAACAGAATGG - Intergenic
1201117952 Y:10848916-10848938 TGGAGTGGAATAGAATAGAGTGG - Intergenic
1201118751 Y:10856876-10856898 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201118813 Y:10857361-10857383 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201118944 Y:10858237-10858259 TGGAATGGAATTGTGTGGATTGG - Intergenic
1201120367 Y:10868233-10868255 TGGAGCGGAATTCAATGGAATGG - Intergenic
1201120670 Y:10870376-10870398 TGGAGTGGAATTTTGTAGAATGG - Intergenic
1201120671 Y:10870391-10870413 TGGAGTGGAATTGAATGGAGTGG - Intergenic
1201120771 Y:10871131-10871153 TGGAGTGGAATTGAATGGAATGG - Intergenic
1201121183 Y:10874799-10874821 TGGAATGGAATTGAATAGAACGG - Intergenic
1201122091 Y:10880972-10880994 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201122419 Y:10883364-10883386 TGGAGTGGAATGCAATGGAACGG - Intergenic
1201122462 Y:10883706-10883728 TGGAATGGAATGCAAAAGATTGG - Intergenic
1201122737 Y:10885480-10885502 TGGAGTGGAATGGAATAGAGTGG - Intergenic
1201123185 Y:10888817-10888839 TGGAGTGGAATACAATTGAGTGG - Intergenic
1201123210 Y:10889007-10889029 TGGAATGGAATGCAATAGAGTGG - Intergenic
1201123437 Y:10892095-10892117 TGGAGTGGAATGGAATAGAGTGG - Intergenic
1201123525 Y:10892809-10892831 TGGAGTGGAATGCAATGGAATGG - Intergenic
1201123694 Y:10893825-10893847 TGGAGTGGAATGTAATAGAGTGG - Intergenic
1201124083 Y:10898197-10898219 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201124095 Y:10898282-10898304 TGGAGTGGAATGCAATGGAATGG - Intergenic
1201126745 Y:10921802-10921824 TGGAGTGGAATTGAATGGAATGG - Intergenic
1201127070 Y:10925112-10925134 TGGAGTGGATTTGAATAGAGTGG - Intergenic
1201127419 Y:10927603-10927625 TGGAGTGGAATGCAATGGAATGG - Intergenic
1201127482 Y:10928008-10928030 TGGAGTGGAATTCAATGGAGTGG - Intergenic
1201128199 Y:10932819-10932841 TGGAGTGGAGTTCAGTAGAGTGG - Intergenic
1201128320 Y:10933721-10933743 TGGAGTGGAATTGAATGGATTGG - Intergenic
1201128731 Y:10936636-10936658 TGGAGTGGAATTCAGTGGAGAGG - Intergenic
1201128836 Y:10937429-10937451 TGGAGTGGAATGGAATTGATTGG - Intergenic
1201128899 Y:10937864-10937886 TGGAATGGAATGGTATAGAATGG - Intergenic
1201129580 Y:10942496-10942518 TGGAGTGGAATGCAATGGAGTGG - Intergenic
1201130147 Y:10946288-10946310 TGGAGTGGAATTGAATGGAATGG - Intergenic
1201130305 Y:10947207-10947229 TGGAGTGGAATGCAATGGAAAGG - Intergenic
1201130657 Y:10949502-10949524 TGGAGTGCAATGGAATAGATTGG - Intergenic
1201131053 Y:10952279-10952301 TGGAGTGGAGTTCAATGGAATGG - Intergenic
1201131078 Y:10952429-10952451 TGGAGTGGAATGTAATAGATTGG - Intergenic
1201131105 Y:10952604-10952626 TGGAATGGAATGCCATGGATTGG - Intergenic
1201131427 Y:10954700-10954722 TGGAGTGGAATGAAATGGATAGG - Intergenic
1201131554 Y:10955515-10955537 TGGAGTGGAATGGAATAGAATGG - Intergenic
1201131578 Y:10955692-10955714 TGGAGTGGAATTCTATGGAATGG - Intergenic
1201132250 Y:10961315-10961337 TGGACTGGAATGGAATAGATTGG - Intergenic
1201132332 Y:10962672-10962694 TGGAGTGGAATGCAATGGAATGG - Intergenic
1201132420 Y:10963207-10963229 TGGAGTGGAATGGTATGGAGTGG - Intergenic
1201132441 Y:10963312-10963334 TGGAGTGGAATGGAATAGAGTGG - Intergenic
1201132624 Y:10964741-10964763 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201132628 Y:10964761-10964783 TGGAGTGGAGTGGAATAGATTGG - Intergenic
1201133237 Y:10971209-10971231 TGGAGTGGAATTAATTCGATTGG - Intergenic
1201133820 Y:10975425-10975447 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201134285 Y:10978742-10978764 TGGAGTGGAATTCAGTGGAGTGG - Intergenic
1201134827 Y:10982665-10982687 TGGAGTGGAATTAAGTGGATTGG - Intergenic
1201134864 Y:10982885-10982907 TGGAGTGGAGTTCAATAGAGTGG - Intergenic
1201135410 Y:10986513-10986535 TGGAGTGGAATTGAATGGACAGG - Intergenic
1201136590 Y:10994713-10994735 TGGAGTGGATTTGAATGGATTGG - Intergenic
1201136668 Y:10995327-10995349 TGGAGTGGAATCTAATGGATTGG - Intergenic
1201137254 Y:10999383-10999405 TGGAATGGAATACAATTGATTGG - Intergenic
1201137728 Y:11003500-11003522 TGGAGTGGAATTCAGTGGAGTGG - Intergenic
1201137937 Y:11004933-11004955 TGGAGTGGAATGCTGTGGAGTGG - Intergenic
1201138260 Y:11007192-11007214 TGGAGTGGAATGAAATGGATTGG - Intergenic
1201138469 Y:11008585-11008607 TGGAATGGAATGAAATAGATTGG - Intergenic
1201138652 Y:11009947-11009969 TGGAGTGGAGTTCAGTAGAGTGG - Intergenic
1201139057 Y:11013363-11013385 TGGAATGGAATGCAATAGAATGG - Intergenic
1201139355 Y:11015475-11015497 TGGAATGGAATGCTATGGAATGG - Intergenic
1201139668 Y:11018032-11018054 TGGAGTGGAATAGAGTAGATTGG - Intergenic
1201139999 Y:11020272-11020294 TGGAGTGGAATTCAGTGGGTTGG - Intergenic
1201140241 Y:11021940-11021962 TGGAGTGGAACGCTCTGGATTGG - Intergenic
1201140244 Y:11021960-11021982 TGGAGTGGAACGCTCTGGATTGG - Intergenic
1201141171 Y:11030053-11030075 TGGAGTGGAATTATTTGGAGTGG - Intergenic
1201141532 Y:11032583-11032605 TGGAGTGGAATGGAATGGATTGG - Intergenic
1201141664 Y:11033566-11033588 TGGAGTGGAATTTAATGGAATGG - Intergenic
1201142388 Y:11039647-11039669 TGGAGTAGAATGGAATAGATTGG - Intergenic
1201173379 Y:11292553-11292575 TGGAGTGGAATTCGGTGGAGTGG - Intergenic
1201174033 Y:11296785-11296807 TGGAGTGGAATTGAATGGAGTGG - Intergenic
1201174228 Y:11298056-11298078 TGGAATGGAATTTCATAGAATGG - Intergenic
1201174281 Y:11298435-11298457 TGGAATGGAATGCTATGGAAAGG - Intergenic
1201174861 Y:11302259-11302281 TGGAGTGGAATTGAATTGAATGG - Intergenic
1201196301 Y:11497778-11497800 TGGAATGCAATACTATGGATTGG + Intergenic
1201197148 Y:11505528-11505550 TGGAGTGGCATTGAATAGAATGG + Intergenic
1201197166 Y:11505643-11505665 TGGAATGGAATTCAATGGAATGG + Intergenic
1201197294 Y:11506859-11506881 TGGAATGGAATCGAATAGATTGG + Intergenic
1201198146 Y:11514393-11514415 TTGAATGGAATTGAATAGATTGG + Intergenic
1201198335 Y:11516153-11516175 TGGAATGGAATTCGATGGAATGG + Intergenic
1201199034 Y:11522446-11522468 TGGAATGGAATCCAATAGAGTGG + Intergenic
1201200146 Y:11532429-11532451 TGGAGTGGAATTGAATGGAATGG + Intergenic
1201202164 Y:11550281-11550303 TGGAGTGGAATTGAATGGAATGG + Intergenic
1201202816 Y:11555961-11555983 TGGAGTGGAATTGAATGGAATGG + Intergenic
1201203459 Y:11561523-11561545 TGGAGTGGAATTGAATGGAATGG + Intergenic
1201207215 Y:11643782-11643804 TGGAATGGAATGGAATAGATTGG + Intergenic
1201207345 Y:11645051-11645073 TGGATTGGAATGCAATGGATAGG + Intergenic
1201207389 Y:11645436-11645458 TGGAATGGAATTGTATGGAATGG + Intergenic
1201207710 Y:11648592-11648614 TGGAGTGGAATACAATGGAATGG + Intergenic
1201207759 Y:11649083-11649105 TGGAGTGCAATGCAATAGAATGG + Intergenic
1201207840 Y:11649701-11649723 TGGAATGGAATGGTATGGATTGG + Intergenic
1201208929 Y:11659710-11659732 TGGAATGGAATGCAATAGAATGG + Intergenic
1201209266 Y:11664479-11664501 TGGAATGGAATACTATGGAATGG + Intergenic
1201209522 Y:11666793-11666815 TGGAATGGAATTAAATAGAATGG + Intergenic
1201210350 Y:11674846-11674868 TGGAATGGAATTCAATAGTATGG + Intergenic
1201210418 Y:11675510-11675532 TGGAATGGAATTGAATAGAATGG + Intergenic
1201210858 Y:11679218-11679240 TGGAGTGGAATTGAATGGAATGG + Intergenic
1201210860 Y:11679233-11679255 TGGAATGGAATTCAATGGATCGG + Intergenic
1201210864 Y:11679283-11679305 TGGAATGGAATGCAATAGAATGG + Intergenic
1201210979 Y:11680336-11680358 TGGAGTGGAATTGGATAGAACGG + Intergenic
1201211663 Y:11686480-11686502 TGGACTGGAATTGAATAGACAGG + Intergenic
1201211768 Y:11687378-11687400 AGGAGTGGAATTCAATGGAATGG + Intergenic
1201212106 Y:11690151-11690173 TGGAATGGAATGGAATAGATTGG + Intergenic
1201212606 Y:11694340-11694362 TGGAGTGGAATGGAATATATTGG + Intergenic
1201213098 Y:11698564-11698586 TCGAATGGAATTCAATAGAATGG + Intergenic
1201214350 Y:11709108-11709130 TGGAATGGAATTCAATACAATGG + Intergenic
1201214858 Y:11713669-11713691 TGGAATGGAATTGAATAGAAGGG + Intergenic
1201214878 Y:11713879-11713901 TGGAATGGAATTGAATAGAATGG + Intergenic
1201215704 Y:11720817-11720839 TGGAATGGAATTCAATGGATTGG + Intergenic
1201216568 Y:11727935-11727957 TCGAATGGAATTCAATAGAATGG + Intergenic
1201217009 Y:11731789-11731811 TGGAATGGAATTTAATAGAATGG + Intergenic
1201217253 Y:11733950-11733972 TTGAGTGGAATGCAATAGAATGG + Intergenic
1201218018 Y:11740167-11740189 TGGAGTGGAATTGAATGGAATGG + Intergenic
1201218020 Y:11740187-11740209 TGGAATGGAATCGAATAGATTGG + Intergenic
1201218208 Y:11741822-11741844 TGGAGTAGAATACAATAGAATGG + Intergenic
1201218809 Y:11747014-11747036 TCGAATGGAATTCAATAGAATGG + Intergenic
1202364603 Y:24149099-24149121 TTGAGCGTAATTCTCTAGATGGG + Intergenic
1202506178 Y:25521023-25521045 TTGAGCGTAATTCTCTAGATGGG - Intergenic
1202605897 Y:26639493-26639515 TGGAGTGGAATGGAATAGAAAGG + Intergenic
1202606076 Y:26640759-26640781 TGGAGTGGAATTGAATGGAGTGG + Intergenic
1202606229 Y:26641904-26641926 TGGAATGGAATGCAATAGAGAGG + Intergenic
1202606484 Y:26643729-26643751 TGGAGTGGAATGGAATGGATTGG + Intergenic
1202606694 Y:26645224-26645246 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202606781 Y:26645936-26645958 TGGATTGGAAATCTATGGAGAGG + Intergenic
1202607060 Y:26648104-26648126 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202607100 Y:26648432-26648454 TGGAGTGGATTCCAATGGATTGG + Intergenic
1202607107 Y:26648467-26648489 TGGAATGGAATGGAATAGATTGG + Intergenic
1202607149 Y:26648817-26648839 TGGATTGGAAATCTATGGAGAGG + Intergenic
1202607432 Y:26650977-26650999 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202607479 Y:26651340-26651362 TGGAATGGAATGGAATAGATTGG + Intergenic
1202607524 Y:26651689-26651711 TGGATTGGAACTCTATGGAGAGG + Intergenic
1202607570 Y:26651974-26651996 TAGAGTGGAATTGAATAGAATGG + Intergenic
1202608273 Y:26657487-26657509 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202608306 Y:26657765-26657787 TGGAGTGGAATGGAATAGAGAGG + Intergenic
1202608322 Y:26657850-26657872 TGGAATGGAATGGAATAGATTGG + Intergenic
1202608689 Y:26660743-26660765 TGGAATGGAATGGAATAGATTGG + Intergenic
1202608729 Y:26661092-26661114 TGGATTGGAACTCTATGGAGAGG + Intergenic
1202609055 Y:26663591-26663613 TGGAATGGAATGGAATAGATTGG + Intergenic
1202609097 Y:26663940-26663962 TGGATTGGAACTCTATGGAGAGG + Intergenic
1202609386 Y:26666081-26666103 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202609432 Y:26666444-26666466 TGGAATGGAATGGAATAGATTGG + Intergenic
1202609477 Y:26666793-26666815 TGGATTGGAACTCTATGGAGAGG + Intergenic
1202609585 Y:26667590-26667612 TGGAGTGGAATGCAATGGAATGG + Intergenic
1202609894 Y:26669932-26669954 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202609937 Y:26670275-26670297 TGGAATGGAATGGAATAGATTGG + Intergenic
1202610279 Y:26672804-26672826 TGGAATGGAATGGTATAGAGTGG + Intergenic
1202610312 Y:26673082-26673104 TGGAGTGGAATGGAATAGAGAGG + Intergenic
1202610328 Y:26673167-26673189 TGGAATGGAATGGAATAGATTGG + Intergenic
1202613011 Y:56695935-56695957 TGCAGTGGAATGCTATGGAATGG + Intergenic
1202614681 Y:56710176-56710198 TGCAGTGGAATGCTATGGAATGG + Intergenic
1202616312 Y:56724083-56724105 TCGAATGGAATTCAATCGATTGG + Intergenic
1202622790 Y:56830337-56830359 TGGAGTGGAATGCAATGGAATGG - Intergenic
1202622919 Y:56831233-56831255 TGGACTGGAATTCAGTGGATTGG - Intergenic
1202623418 Y:56834477-56834499 TGGAGTGGAATGCAATCGAATGG - Intergenic
1202623437 Y:56834582-56834604 TGGAGTGGAATGCAATGGAATGG - Intergenic
1202623565 Y:56835500-56835522 TGGAGTGGAATGGAATGGATTGG - Intergenic