ID: 1018903429

View in Genome Browser
Species Human (GRCh38)
Location 6:168062487-168062509
Sequence GGCCCTGGCCCTGCAGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903429_1018903441 24 Left 1018903429 6:168062487-168062509 CCCACGCCTGCAGGGCCAGGGCC 0: 1
1: 0
2: 3
3: 41
4: 362
Right 1018903441 6:168062534-168062556 ACGGCCCTGATGCCCCCGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1018903429_1018903434 -4 Left 1018903429 6:168062487-168062509 CCCACGCCTGCAGGGCCAGGGCC 0: 1
1: 0
2: 3
3: 41
4: 362
Right 1018903434 6:168062506-168062528 GGCCAGGCACAAAGCCCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 153
1018903429_1018903436 1 Left 1018903429 6:168062487-168062509 CCCACGCCTGCAGGGCCAGGGCC 0: 1
1: 0
2: 3
3: 41
4: 362
Right 1018903436 6:168062511-168062533 GGCACAAAGCCCGTGAGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 178
1018903429_1018903443 28 Left 1018903429 6:168062487-168062509 CCCACGCCTGCAGGGCCAGGGCC 0: 1
1: 0
2: 3
3: 41
4: 362
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903429_1018903437 5 Left 1018903429 6:168062487-168062509 CCCACGCCTGCAGGGCCAGGGCC 0: 1
1: 0
2: 3
3: 41
4: 362
Right 1018903437 6:168062515-168062537 CAAAGCCCGTGAGGCCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903429 Original CRISPR GGCCCTGGCCCTGCAGGCGT GGG (reversed) Intronic