ID: 1018903432

View in Genome Browser
Species Human (GRCh38)
Location 6:168062493-168062515
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 0, 2: 14, 3: 83, 4: 668}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903432_1018903441 18 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903441 6:168062534-168062556 ACGGCCCTGATGCCCCCGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1018903432_1018903443 22 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903432_1018903434 -10 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903434 6:168062506-168062528 GGCCAGGCACAAAGCCCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 153
1018903432_1018903445 26 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903445 6:168062542-168062564 GATGCCCCCGAGAGGCCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 116
1018903432_1018903447 30 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903432_1018903437 -1 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903437 6:168062515-168062537 CAAAGCCCGTGAGGCCAGGACGG No data
1018903432_1018903436 -5 Left 1018903432 6:168062493-168062515 CCTGCAGGGCCAGGGCCAGGCAC 0: 1
1: 0
2: 14
3: 83
4: 668
Right 1018903436 6:168062511-168062533 GGCACAAAGCCCGTGAGGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903432 Original CRISPR GTGCCTGGCCCTGGCCCTGC AGG (reversed) Intronic