ID: 1018903433

View in Genome Browser
Species Human (GRCh38)
Location 6:168062502-168062524
Sequence ACGGGCTTTGTGCCTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903433_1018903443 13 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903433_1018903437 -10 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903437 6:168062515-168062537 CAAAGCCCGTGAGGCCAGGACGG No data
1018903433_1018903447 21 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data
1018903433_1018903449 22 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903449 6:168062547-168062569 CCCCGAGAGGCCGGCAGGAAGGG No data
1018903433_1018903445 17 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903445 6:168062542-168062564 GATGCCCCCGAGAGGCCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 116
1018903433_1018903441 9 Left 1018903433 6:168062502-168062524 CCAGGGCCAGGCACAAAGCCCGT 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1018903441 6:168062534-168062556 ACGGCCCTGATGCCCCCGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903433 Original CRISPR ACGGGCTTTGTGCCTGGCCC TGG (reversed) Intronic