ID: 1018903435

View in Genome Browser
Species Human (GRCh38)
Location 6:168062508-168062530
Sequence GGCCTCACGGGCTTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903435_1018903449 16 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903449 6:168062547-168062569 CCCCGAGAGGCCGGCAGGAAGGG No data
1018903435_1018903441 3 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903441 6:168062534-168062556 ACGGCCCTGATGCCCCCGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1018903435_1018903445 11 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903445 6:168062542-168062564 GATGCCCCCGAGAGGCCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 116
1018903435_1018903443 7 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903435_1018903447 15 Left 1018903435 6:168062508-168062530 CCAGGCACAAAGCCCGTGAGGCC No data
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903435 Original CRISPR GGCCTCACGGGCTTTGTGCC TGG (reversed) Intronic