ID: 1018903438

View in Genome Browser
Species Human (GRCh38)
Location 6:168062520-168062542
Sequence CAGGGCCGTCCTGGCCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 262}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903438_1018903441 -9 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903441 6:168062534-168062556 ACGGCCCTGATGCCCCCGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1018903438_1018903453 20 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903453 6:168062563-168062585 GGAAGGGACCTGCACCTCTTCGG 0: 1
1: 0
2: 3
3: 14
4: 154
1018903438_1018903454 21 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903454 6:168062564-168062586 GAAGGGACCTGCACCTCTTCGGG No data
1018903438_1018903445 -1 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903445 6:168062542-168062564 GATGCCCCCGAGAGGCCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 116
1018903438_1018903443 -5 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903443 6:168062538-168062560 CCCTGATGCCCCCGAGAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1018903438_1018903449 4 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903449 6:168062547-168062569 CCCCGAGAGGCCGGCAGGAAGGG No data
1018903438_1018903447 3 Left 1018903438 6:168062520-168062542 CCCGTGAGGCCAGGACGGCCCTG 0: 1
1: 0
2: 2
3: 23
4: 262
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903438 Original CRISPR CAGGGCCGTCCTGGCCTCAC GGG (reversed) Intronic