ID: 1018903440

View in Genome Browser
Species Human (GRCh38)
Location 6:168062529-168062551
Sequence CGGGGGCATCAGGGCCGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018903440_1018903449 -5 Left 1018903440 6:168062529-168062551 CCAGGACGGCCCTGATGCCCCCG No data
Right 1018903449 6:168062547-168062569 CCCCGAGAGGCCGGCAGGAAGGG No data
1018903440_1018903454 12 Left 1018903440 6:168062529-168062551 CCAGGACGGCCCTGATGCCCCCG No data
Right 1018903454 6:168062564-168062586 GAAGGGACCTGCACCTCTTCGGG No data
1018903440_1018903445 -10 Left 1018903440 6:168062529-168062551 CCAGGACGGCCCTGATGCCCCCG No data
Right 1018903445 6:168062542-168062564 GATGCCCCCGAGAGGCCGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 116
1018903440_1018903453 11 Left 1018903440 6:168062529-168062551 CCAGGACGGCCCTGATGCCCCCG No data
Right 1018903453 6:168062563-168062585 GGAAGGGACCTGCACCTCTTCGG 0: 1
1: 0
2: 3
3: 14
4: 154
1018903440_1018903447 -6 Left 1018903440 6:168062529-168062551 CCAGGACGGCCCTGATGCCCCCG No data
Right 1018903447 6:168062546-168062568 CCCCCGAGAGGCCGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018903440 Original CRISPR CGGGGGCATCAGGGCCGTCC TGG (reversed) Intronic